מֵידָע

מה קורה כשאנחנו מתחילים מחדש תגובת PCR?


לאחרונה כאשר תגובת ה- PCR שלי רצה היו תנודות כוח והמעבדה כולה הושחרה לכמה דקות ולצערי ה- PCR שהפעלתי נכבה. אז, האם זה יהיה בסדר להפעיל מחדש את ה- PCR? מה היה קורה אם אותה תוכנית PCR הייתה מופעלת שוב?


הפולימראז המשמש ב- PCR יציב במיוחד בטמפרטורת החדר. הייתי מצפה שתוכל להמשיך את תגובת ה- PCR שלך מהמחזור בו נעצרה בלי יותר מדי בעיות. עם זאת, חשוב לא להחזיר את המוצר שלך למחזור. זה ייצר מוצרים לא ספציפיים. אם תוצאה נקייה היא הכרחית, קח מדגם 1-5ul מהתגובה המקורית שלך לשימוש בתור תבנית בתגובה חדשה.


במקרה זה תוכל להריץ את ה- PCR למשך 18 מחזורים נוספים (אם מספר המחזורים הכולל שלך היה 30). עם זאת, בצע את הדנטורציה הראשונית למשך 1-2 דקות. אתה עשוי להריץ את אותה תוכנית שוב (30 מחזורים מלאים), אך בסופו של דבר אתה רק מבזבז זמן כי אחרי נקודה כל ה- dNTPs והפריימרים ימוצו ולמחזורים נוספים לא תהיה השפעה על ריכוז האמפליקון.


שאל מומחה: שאלה טיפשית לגבי PCR.

אני מבין איך PCR עובד. ה- DNA מתערער והופך לשני ssDNA. הפריימר קדימה מחבר את עצמו לגדיל אחד והפריימר ההפוך מחבר את עצמו לאחרת.

השאלה שלי היא איך הפריימר יודע מתי להפסיק לסנתז?

לדוגמה, נניח שרצף ה- DNA הכפול שלנו הוא זה:

5 'GTTTTTTTTTTTAAAAAAAAAAG3'
3 'CAAAAAAAAAATTTTTTTTTTC5'

אז הפריימר קדימה יהיה אומר כך: 5'GTTTTTTT3 '
הפריימר ההפוך הוא: 5'GAAAAAA3 '

כעת, כאשר ה- dsDNA מכפיש והופך לשני ssDNA, הפריימרים יצורפו. עם זאת, האם הפריימר לא ימשיך לסנתז לנצח? מלבד שזמן החישול שהסתיים, כיצד יודע הפריימר מתי להפסיק?

בתחילה התשובה שלי לשאלה זו הייתה השימוש בקודוני עצירה. אבל הקודונים משמשים למעשה במהלך התרגום ואינם חשובים ב- PCR בפועל?

פרסם על ידי גנוטיפ & raquo יום שישי 25 בנובמבר 2005 1:07 בבוקר

סליחה, רק רציתי להוסיף משהו לפוסט המקורי.

השאלה שלי נוגעת למה שקורה אם יש לך פריימרים שאמורים להיות ספציפיים לגן בתוך תבנית ה- DNA.

אני יודע שאם המטרה הייתה רק להגביר כמה שיותר מתבנית ה- DNA המקורית, אז הפריימר פשוט ימשיך לסנתז עד שיגיע לסוף ה- DNA. עם זאת, אם אנו מנסים לבצע PCR של גן ספציפי בתוך תבנית DNA ענקית, כיצד הפריימר יודע מתי להפסיק?

השב לשאלות PCR

פרסם על ידי donnahardy2 & raquo יום שני 28 בנובמבר 2005 14:30

הפולימראז אינו יודע מתי להפסיק. הוא עשוי לסנתז מאות או אלפי בסיסים נוספים לפני: 1) הפולימראז פשוט נופל באופן טבעי מה שקורה לעתים קרובות מה שמקשה על סינתזה של פיסות DNA ארוכות מאוד על ידי PCR או 2) זמן המחזור במרוץ התרמו -מחזור והטמפרטורה יורדת עד מעל 90 מעלות והחום הנוסף גורם לפולימראז ליפול.

זה לא משנה. סינתזת ה- DNA הארוכה במיוחד תתקיים רק עם ה- DNA המקורי של התבנית שעובר דרך ארוכה לשני הכיוונים. בקרוב יהיו הרבה יותר פיסות DNA שסונתזו החל מפריימר אחד ולכן יש לו נקודת עצירה מוגדרת (ה- DNA מסתיים) כאשר הסינתזה מתחילה בפריימר השני והולכת לכיוון השני. כאשר זה יקרה ל- DNA תהיה נקודת עצירה מוגדרת משני הקצוות וכל ה- DNA החדש שייווצר יהיה באורך קבוע. תמונה מראה את זה הכי טוב. הכנסתי כמה אזורי פריימר (קצרים).

סיטואציה מתחילה (לאחר דינאטור ה- DNA)

סבב ההגברה הבא

דרכי הגברה נוספות

כך שבסופו של דבר כמעט כל מוצרי ה- PCR יהיו באורך הקצר בלבד. יהיו כמה חלקים ארוכים יותר (אחד לכל כיוון לכל אחד מ -40 מחזורי ההגברה), אבל זה יהיה סכום כל כך קטן בהשוואה למיליארדים ומיליארדי החלקים הקצרים שלא תוכל להבחין בהם.


מה קורה כשאנחנו מתחילים מחדש תגובת PCR? - ביולוגיה

על מנת לצפות בתוכן זה נדרשת מנוי ל- J o VE. תוכל לראות רק את 20 השניות הראשונות.

נגן הווידאו JoVE תואם HTML5 ו- Adobe Flash. דפדפנים ישנים יותר שאינם תומכים ב- HTML5 ובקודק הווידאו H.264 עדיין ישתמשו בנגן וידאו מבוסס Flash. אנו ממליצים להוריד כאן את הגרסה החדשה ביותר של Flash, אך אנו תומכים בכל הגרסאות 10 ומעלה.

אם זה לא עוזר, אנא יידע אותנו.

מטרת ה- PCR, Polymerase Chain Reaction היא להגביר רצף גנטי. בדוגמה זו, גן מעניין יוגבר מ- DNA מטוהר. על מנת לבצע את ההגברה, נדרש פולימראז לסינתזת ה- DNA החדש.

יש צורך גם בפריימר, פיסה קצרה של DNA חד -גדילי החולק הומולוגיה לגן העניין. לבסוף, נוקלאוטידים בודדים הנקראים Deoxynucleoside triphosphates או dNTP משמשים לייצור הגדיל החדש. השלב הראשון ב- PCR הוא לחמם את התערובת הגורסת את ה- DNA.

לאחר מכן, התגובה מתקררת והפריימרים יחלחלו לאזור ההומולוגי שלהם. לאחר קשירת התגובה מחוממת לטמפרטורה אופטימלית עבור הפולימראז. לאחר מכן הפולימראז מזהה את מכלול ה- DNA פריימר ומתחיל בסינתזה של הגדיל החדש באמצעות ה- dNTP בתמיסה.

התגובה מתחממת ואז מתמשכת כמתואר לאורך מחזורים נוספים. לאחר המחזור השלישי, ישנם שמונה עותקים של הגן. לאחר המחזור הרביעי, 16 עותקים.

ומחזור חמישי, 32 עותקים. מספר המחזורים ימשיך לגדול באופן אקספוננציאלי. לאחר 30 מחזורים, יש קצת יותר ממיליארד עותקים.

15.14: PCR

סקירה כללית

תגובת שרשרת הפולימראז, או PCR, היא טכניקה נפוצה להעתקת קטעי DNA. בשל הגברה מעריכית, PCR יכול לייצר מיליוני או מיליארדי עותקי DNA בתוך שעות ספורות בלבד. בתגובת PCR, אנזים DNA פולימראז עמיד בחום מעצים את ה- DNA המקורי באמצעות סדרה של שינויי טמפרטורה בתוך מכונה אוטומטית הנקראת thermocycler.

PCR היא שיטה תכליתית שחוללה מהפכה בביולוגיה המולקולרית

קארי מוליס פיתח PCR בשנת 1983, ועל כך הוענק לו פרס נובל לכימיה לשנת 1993. בהיותו דרך מהירה, זולה ומדויקת להעתיק רצף DNA, ה- PCR הפך לכלי בעל ערך רב ליישומים רבים, כולל שיבוט מולקולרי, מוטגנזה גנטית, זיהוי פתוגנים, ניתוח ביטוי גנים, כימות DNA ורצף, ואבחון מחלות גנטיות.

מחזור תגובת ה- PCR

PCR מחקה את תהליך שכפול ה- DNA הטבעי המתרחש בתאים. תערובת התגובה כוללת רצף DNA תבנית שיש להעתיק, זוג מולקולות DNA קצרות הנקראות פריימרים, אבני בניין חופשיות של DNA הנקראות deoxynucleotide triphosphates (dNTPs), ואנזים מיוחד של פולימראז DNA.

PCR כולל סדרה של שלבים בטמפרטורות גבוהות הדורשות אנזים DNA פולימראז המתפקד בטמפרטורות כאלה. הפולימראז ה- DNA הנפוץ ביותר הוא טאק פולימראז, על שם Thermus aquaticus, החיידק שממנו בודד הפולימראז בתחילה. פולימראז DNA אינו מסוגל לסנתז מולקולת DNA מאפס, או דה נובו. במקום זאת, פולימראז ה- DNA מוסיף למולקולות DNA קצרות, הנקראות פריימרים, הנקשרות לתבנית ה- DNA באמצעות זיווג בסיס משלים. הפריימרים מספקים קבוצת 3 הידרוקסיל בחינם שאליה פולימראז DNA יכול לצרף dNTPs חדשים. ישנם ארבעה סוגים של dNTPs ב- PCR, אחד לכל נוקלאוטיד במולקולת ה- DNA: dATP, dCTP, dGTP ו- dTTP.

כל מחזור PCR מורכב משלושה שלבים: דנטורציה, חישול וסינתזה של DNA.

  1. דנטורציה. מחזור ה- PCR מופעל על ידי חימום תערובת התגובה לטמפרטורה גבוהה, וגורם להפרדה של סליל ה- DNA הכפול לשני גדילים. תהליך זה & התכה והתרגשות מתרחש בדרך כלל בטמפרטורה של 90 & degC & ביישן & ביישן & ndash100 & degC.
  2. רִכּוּך. תערובת התגובה מתקררת במהירות (בדרך כלל ל- 50 & degC & ndash65 & degC), ומאפשרת לשני הפריימרים להיקשר לרצפים המשלימים שלהם על גדילים ה- DNA של תבנית.
  3. סינתזה של DNA (הרחבת פריימר). תערובת התגובה מחוממת שוב, הפעם לטמפרטורה (בדרך כלל 60 & degC & ndash75 & degC) המאפשרת ל- DNA פולימראז להאריך את הפריימרים על ידי הוספת dNTP המזווג עם הבסיסים בגדיל התבנית.

PCR טיפוסי כולל 20-40 מחזורים חוזרים ונשנים של שלושת השלבים הללו, המתרחשים במתרמולר. מכיוון שמספר מולקולות ה- DNA מוכפל בכל מחזור, ה- DNA מוגבר באופן אקספוננציאלי.

מגבלות ה- PCR

אם המדען רוצה להעצים קטע ספציפי של הגנום, על המדען להכיר לפחות חלק מרצף ה- DNA היעד לעיצוב פריימרים מתאימים. סוגיה פוטנציאלית נוספת היא חישול לא ספציפי של פריימרים לרצפי DNA דומים חלקית, מה שמוביל להגברה של DNA שאינו מטרה. ניתן לשלוט בנושא זה על ידי ייעול תנאי התגובה. בהיותו שיטת זיהוי רגישה ביותר, PCR פגיע גם לזיהום, ואפילו כמויות עקבות של DNA מזהם עלולות לגרום לתוצאות מטעות. פולימראז ה- DNA המשמש ב- PCR יכול להיות מועד לטעויות. אם המוטציה מתרחשת בתוך המחזורים הראשונים, רוב ה- DNA המוגבר יישא את המוטציה.

גריביאן, לילית ונידה אבשיה. & טכניקות מחקר פשוטות: תגובת שרשרת פולימראז (PCR). & rdquo כתב העת לדרמטולוגיה חוקרת 133, לא. 3 (מרץ 2013): e6. [מָקוֹר]

התפלל, לסלי א. & Ldquo מהפכת הביוטכנולוגיה: PCR ושימוש בתעתיק הפוך לגנים המובאים לשיבוט. & Rdquo חינוך טבע 1, לא. 1 (2008): 94. [מקור]


מהם היתרונות של PCR על פני שיבוט גנים ליצירת עותקים רבים של שבר DNA?

DNA שיבוט כולל בידוד של קטע ספציפי של DNA ובדרך כלל החדרת השבר לפלסמיד כך שחיידק יוכל לשכפל את ה- DNA. PCR משתמש בשני פריימרים ספציפיים על מנת לשכפל ולבודד רצף DNA ספציפי. מה זה הבדל בין שיבוט גנים ושחזור DNA?

כמו כן, מה היה קורה אם היית משתמש בפולימראז אנושי בסדרה של תגובות PCR? קרא את זה! קצב האנזים המזורז תגובה יכולה יושפעו גם מנוכחותן של מולקולות אחרות פחית נקשרים לאנזים ומשנים את צורתו. בחלק תגובות יש צורך בקו -אנזים.

השאלה היא גם מדוע אתה צריך לשבט את שברי ה- PCR לצורך רצף נוסף?

לאחר רצף שיבוט הוא נחוץ כי כדי לאשר שזה מה שלא יהיה רצף שאנחנו משבטים (שנותן ביטוי) אם זה סדר פעולות קיים ב רצף נתונים אז אָנוּ יכול לומר כי שלנו שיבוט התוצאות נכונות.

כיצד משתמשים ב- PCR בשיבוט DNA?

שיבוט PCR שיטה. זה מאפשר את שיבוט שֶׁל DNA שברים שאינם זמינים בכמויות גדולות. בדרך כלל, א PCR התגובה מתבצעת כדי להגביר את רצף העניין, ולאחר מכן היא מחוברת לווקטור באמצעות קשירת בלאנג או בסיסה אחת לפני טרנספורמציה.


PCR: האם אתה יכול לקבל הגברה אם רק פריימר אחד מחליק? - מוצר pcr באותו גודל באמצעות 2 ערכות פריימר שונות (25 ביולי/2007)

שלום כולם,
אשמח לשמוע את דעתכם על המצב הבא:

תכננתי שתי מערכות פריימר שונות להעצמת אותו הגן. שני תחילת החושים נמצאים באקסון 1 אך מחליקים לחלקים שונים של האקסון. הם צמודים זה לזה אך אינם חופפים זה לזה. פריימר אחד נגד חשיבה נמצא בקצה 5 ' של אקסון 6 והשני באקסון 7. המוצר עבור ערכת פריימר אקסון 1-6 הוא 671bp ואקסון 1-7 הוא 3.4kb (אקסון 6 די גדול). כשאני עושה את ה- pcr באמצעות כל אחת ממערכות הפריימרים ואותו cDNA אני מקבל אמליקון שהוא באותו גודל לשתי ערכות הפריימר. האם ייתכן שרק פריימר החושים שלי הוא חישול וההגברה מתרחשת רק בכיוון קדימה ויש לי מוצר חלופי? כל מחשבה בנושא תתקבל בברכה.
תודה

לא בטוח שאני מבין את שאלתך במדויק אבל אם רק פריימר אחד הוא חישול (קדימה או אחורה) לא תקבל הגברה. כמות המוצר המרבית תהיה DNA חד -גדילי באותו ריכוז כמו התבנית.
ישב

שלום כולם,
אשמח לשמוע את דעתכם על המצב הבא:

תכננתי שתי מערכות פריימר שונות להעצמת אותו הגן. שני תחילת החושים נמצאים באקסון 1 אך מחליקים לחלקים שונים של האקסון. הם צמודים זה לזה אך אינם חופפים זה לזה. פריימר אחד נגד חשיבה נמצא בקצה 5 ' של אקסון 6 והשני באקסון 7. המוצר עבור ערכת פריימר אקסון 1-6 הוא 671bp ואקסון 1-7 הוא 3.4kb (אקסון 6 גדול למדי). כשאני עושה את ה- pcr באמצעות כל אחת ממערכות הפריימרים ואותו cDNA אני מקבל אמליקון שהוא באותו גודל לשתי ערכות הפריימר. האם ייתכן שרק פריימר החושים שלי הוא חישול וההגברה מתרחשת רק בכיוון קדימה ויש לי מוצר חלופי? כל מחשבה בנושא תתקבל בברכה.
תודה

אני תוהה אם אני מקבל רק מוצר ssDNA. אני יודע שישנן טכניקות כמו PCR אסימטרי שמביאות להגברת רק אחד החוטים ולכן חשבתי שאולי זה קורה לתגובה שלי מבלי משים. אם אין לי cDNA באורך מלא אז הפריימר ההפוך שלי לא יכול לחרוש אז אני מגביר רק עם הפריימר קדימה. אני באמת לא מכיר מספיק את הטכניקה כדי לדעת אם זה אפשרי. אני רק מנסה להבין הסבר לקבלת המוצר באותו גודל עם 2 ערכות פריימר שונות.

זה נכון, אתה יכול להגביר רק עם פריימר אחד, אבל זו תהיה תגובה לינארית וגודל המוצר תלוי במהירות הפולימראז. אני בספק אם תראה להקות כלל, מכיוון שאתה לא מקבל הגברה מעריכית, וגם אם אתה רואה להקה, זה לא יהיה חד משמעי.

הייתי הולך על כריכה לא ספציפית. האם בדקת את הפריימרים שלך?

הם ספציפיים לגן שלי וגם היה לי אחד המוצרים ברצף וזה המוצר הנכון. זה די חידה. מעולם לא הצלחתי להגביר את ה- cDNA באורך מלא ומכיוון שזה בבון אני לא יודע את הרצף. חלקים ממנו מאוד הומולוגיים לאדם, יש מספיק הבדלים בשחבורים אלטרנטיביים שאני צריך לדעת את רצף ה- speicifc של הבבון.

זה נכון, אתה יכול להגביר רק עם פריימר אחד, אבל זו תהיה תגובה לינארית וגודל המוצר תלוי במהירות הפולימראז. אני בספק אם תראה להקות כלל, מכיוון שאתה לא מקבל הגברה מעריכית, וגם אם אתה רואה להקה, זה לא יהיה חד משמעי.

הייתי הולך על כריכה לא ספציפית. האם בדקת את הפריימרים שלך?

האם תוכל לרצף את המוצרים לשתי ערכות הפריימר?
אולי יש להם את אותו אורך במקרה, אך מייצגים תמלילים שונים עקב שחבור חלופי (למשל דילוג על אקסונים פנימיים).
אתה יכול גם לבדוק את ההשערה שלך על ידי הגדרת מחשב PCR רק עם החוש שלך או אחד מהפריימרים האנטי -חושיים שלך. במקרה הראשון אתה צריך לקבל מוצר pcr בגודל ובכמויות דומים כמו קודם. הגדרת התגובה רק עם הפריימרים האנטי -חושים שלך לא אמורה להוביל למוצר אם אתה צודק.

אולי אחד הפריימרים שלך נקשר לשני הכיוונים?
האם הפצצת את רצפי הפריימר שלך ובדקת האם הם ספציפיים לגן העניין שלך?

נסה לרצף את המוצר שלך באופן מלא. אם הוא משוכפל, אתה אמור להיות מסוגל לראות מה קורה בקצוות שבהם נמצאים הפריימרים.

הפיצו את הפריימרים שלכם, אך אל תאמינו לזה תמיד. לפעמים BLAST לא מראה התאמה אבל איכשהו הפריימרים מחלחלים לאזורים לא ספציפיים.

אתה יכול לטהר את השבר שלך בג'ל (ואם יש אתרי הגבלה) לנסות לחתוך אותו עם אנזים חיתוך נדיר לפני הרצף שלו. או פשוט סדר אותו אם זה קל יותר.


ELI5: תגובת שרשרת פולימראז (PCR)

תגובת שרשרת הפולימראז (PCR) היא שיטה ל#x27 להגביר את ה-#x27, או ליצור הרבה יותר מ- DNA. זה יכול להיות שימושי מאוד במצבים פליליים, בהם ייתכן שיש לך כמות קטנה מאוד של DNA לעבוד איתו. אם אתה יכול לעשות הרבה יותר מזה, אתה יכול לעשות יותר בדיקות ולקבל תוצאה טובה יותר.

זהו מעגל של חימום וקירור, תוך שימוש באותן שיטות של שכפול DNA שיש לתא רגיל.

תגיד, מלכתחילה, יש לך אורך אחד של DNA כפול תקוע (dsDNA). המחזור הראשון מחמם את המערכת ל -95 מעלות- זה חם מספיק כדי לגרום לחוטי ה- DNA להתפצל ל -2 גדילים בודדים (ssDNA). השלב הבא של המחזור מקרר את המערכת ל -55 מעלות, ומאפשר למולקולות הנקראות 'primers ', המתחילות את שכפול ה- DNA, להתחבר לחוטים הבודדים. השלב הבא מתחמם ל -80 מעלות, שהיא הטמפרטורה הטובה ביותר בה פועל האנזים טאק פולימראז. אנזים זה אחראי להוספת זוגות בסיס (הנקראים נוקלאוטידים- הם נמצאים בתמיסה לפני הוספתו למכונת ה- PCR) לבסיסים ריקים. שלב זה מתקיים עד שה- DNA התארך במלואו לגודלו המקורי.

אז, בסוף מחזור מלא של PCR, יש לך כעת שתיים גדילים של dsDNA. אם נחזור על מעגל זה שוב, אותו דבר קורה, אך הן עם הגדיל החדש והן בגדיל ה- DNA הישן. כל מחזור מכפיל את כמות ה- DNA שיש לך, ו- PCR מופעל בדרך כלל בכ -35 מחזורים.

1,2,4,8,16,32 וכו 'וכו' אתה יכול לראות שזה יהיה מספר עצום עד סוף 35 מחזורים, מספיק לביצוע בדיקות אחרות כדי לקבל תוצאה חזותית היטב.


כיצד מגדירים תגובת PCR?

המרכיבים הבסיסיים של א תגובת PCR כוללים תבנית DNA, פריימרים, נוקלאוטידים, פולימראז DNA ומאגר. תבנית ה- DNA בדרך כלל היא ה- DNA המדגם שלך, המכיל את אזור ה- DNA שיש להגביר. עיצוב פריימר הוא קריטי עבור מצליח תגובת PCR.

באופן דומה, מדוע דרושה תבנית DNA ל- PCR? כמו DNA שכפול באורגניזם, PCR דורש א DNA אנזים פולימראז שיוצר גדילים חדשים DNA, באמצעות גדילים קיימים כ תבניות. יציבות החום הזו הופכת את הטאק פולימראז לאידיאלי עבור PCR. כפי שנראה, טמפרטורה גבוהה משמשת שוב ושוב PCR להכפיש את תבנית DNA, או להפריד את גדיליו.

חוץ מזה, מה הם ארבעת השלבים של PCR?

  • שלב 1: דנטורציה על ידי חום: בדרך כלל החום הוא יותר מ 90 מעלות צלזיוס כאשר מפריד DNA דו-גדילי לשני גדילים בודדים.
  • שלב 2: חישול פריימר לרצף היעד:
  • שלב 3: הרחבה:
  • שלב 4: סוף מחזור ה- PGR הראשון:

מהם שלושת השלבים של PCR?

PCR מבוסס על שלושה שלבים פשוטים הנדרשים לכל תגובה של סינתזת DNA: (1) דנטורציה של התבנית לגדילים בודדים (2) רִכּוּך של פריימרים לכל גדיל מקורי לסינתזת גדילים חדשים ו (3) הארכה של קווצות ה- DNA החדשות מהפריימרים.


מודול 1: שכפול DNA

שלום לכולם, וברוך שובך. היום נדבר על תגובת שרשרת פולימראז ב- PCR קצר. אז זו הטכניקה שתאפשר לנו לעשות יותר עותקים של DNA. במילים אחרות, זוהי טכניקה של הגברה של ה- DNA. אז ראינו כיצד שכפול ה- DNA מתרחש בתוך התאים בתאים אוקריוטים. שזה כרוך במספרים רבים כל כך של אנזימים. וזוהי התגובה השלבית די מסובכת, אנזימים רבים מעורבים. יחד עם זאת, יש צורך בכמה מרכיבים. לכן, תגובת שרשרת פולימראז היא שיטה שתאפשר לנו לבצע את הגברת ה- DNA במעבדה במבחנה. לכן, כאשר משהו קורה בתוך האורגניזמים החיים, תאים חיים, אנו קוראים לזה in vivo. מחוץ לתאים החיים, למשל, במעבדה שאתה עשוי לעשות נקרא במבחנה. אז, נראה היום כיצד תוכל לבצע את הגברת ה- DNA כיצד תוכל ליצור עותקים נוספים של ה- DNA במעבדה שלך. וזה דבר חיוני בהחלט מכיוון שכמות ה- DNA שתוכל לבודד ממקורות שונים במהלך הלימודים שלך, למשל, תאים חולים, למשל מיקרואורגניזמים, יש לך בידוד DNA מהמיקרואורגניזמים מתאים חולים ומקורות אחרים, תאי דם וכן הלאה, ואתה רוצה ללמוד את המאפיינים השונים של אותם גנים, אז הדבר החשוב הוא שהכמות שאתה מבודד היא למעשה קטנה מאוד. ועם זאת, אינך יכול לבצע את צעדי המעבדה שלך, לא תוכל לבצע בהם ניסויים רבים. לכן, זה חיוני בהחלט שנזדקק לכמות גדולה יותר של אותם גנים או לכמות גדולה יותר של ה- DNA הזה. נניח שמישהו שראית, אנו אוספים את האנשים, או את המדענים או אפילו את הצוותים הפורנזיים, הם אוספים דגימת שיער או דגימות דם או דגימות עור מאנשים שנפטרו, אם יש הרבה נפגעים, הרבה תקלות קורות ו ישנם נפגעים רבים שאתה לא מזוהה אותם אנשים. לכן, פעמים רבות מה שאנשים עושים בימינו הצוות הפלילי שהם אוספים אפילו את דגימות השיער ואז מבודדים את ה- DNA ואז הם מגלים את זהותו של האדם. אז, אתה יכול לדמיין את כמות ה- DNA שאתה יכול לבודד מדגימת שיער היא כל כך זעירה, כל כך קטנה שעם זה לא תוכל לבצע בדיקות נאותות במעבדה. אז אתה באמת צריך כמות גדולה יותר של חומר, יותר כמות DNA כדי לבצע את הצרכים שלך לביצוע הניסוי שלך במעבדה. אז חיוני בהחלט להגדיל את כמות ה- DNA וזו הטכניקה שתאפשר לכם ליצור כמויות גדולות יותר של הגן או ה- DNA שבידדתם. זה היופי של שיטה זו ושם באה חשיבותה של שיטה זו. אז, עד שטכניקת ה- PCR, הביוכימיה או הטכניקות הביוכימיות, אפילו כמה כלי כימיה נתקעו. אז, לאחר המצאת ה- PCR, הוא נתן דחיפה עצומה לאנשי הביוכימאים לביוטכנולוגים ואפילו לכימאי שהעלה באמת את רמת המחקר. אז איש המפתח שהבין את כל השלבים האמיתיים לתגובת שרשרת הפולימראז PCR הוא קארי מוליס. קארי מוליס הוא האדם שפיתח את כל מערכות ה- PCR. טכניקת ה- PCR תוכננה במלואה או פותחה במלואה בשנת 1983, לא מזמן, למעשה לא ארוכה במיוחד. והוא קיבל פרס נובל בשנת 1993 וזו אחת ההמצאות הגדולות באמת בעולם או במחקר הביוכימיה, הביוטכנולוגיה והכימיה. אתה יודע, קרי מוליס קיבל למעשה את פרס נובל בכימיה, לא בפיזיולוגיה וברפואה. כי כפי שנראה מאוחר יותר, בקרוב מאוד, כל השיטות שבהן אתה עומד להשתמש במעבדה, כוללות תהליכים כימיים, תגובות כימיות. אז זהו הרקע לתגובות שרשרת הפולימראז. כפי שהשם מרמז, כמובן, אתה יכול להבין שהוא זקוק לפולימראז. וזה תהליך או הערכה שמבוסס על האנזים פולימראז. אז, PCR היא טכניקה להגברת ה- DNA הגנומי שהפקנו מאורגניזמים. זוהי אחת התגליות החשובות ביותר שחל מהפכה במחקר כימי או ביולוגי. זה מאוד מאוד נכון. מהן היישומים המזהים את cDNA פירושו ה- DNA הכרומוזומלי או כל זיהוי DNA גנומי של מוטציות גנומיות? זו אחת הסיבות העיקריות לכך שאנו צריכים לחקור את הגנים מכיוון שאם מבודדים גן מתאים חולים, עלינו לדעת האם יש בתוכו מוטציות או שמדובר באותו גן כמו הנורמלי או איזה סוג של חריגה קרה לגנים האלה. אז, מוטציות גנומיות, אבחון מחלות גנטיות. אז יש הרבה שינויים, שינויים שקורים בגנום, בגלל זה המחלה כמו מחלת פרקינסון, כמו מחלת סוכרת כמו סרטן קורים. אז זה מיועד לאבחון מחלות, זהו כלי חשוב בהחלט. המנהל יראה בקרוב שהוא משלים לשכפול DNA. עכשיו, אם אתה זוכר, תהליך שכפול ה- DNA שהתרחש בתוך התא, אז ראינו שהוא עובר מספר שלבים. עכשיו השאלה היא אם אתה רוצה לעשות את אותם צעדים קצרים יותר, האם אתה יכול לבצע את אותו תהליך במעבדה שלך? האם תוכל לבצע הגברה של ה- DNA או שכפול ה- DNA שראינו במבחנה? אז בואו נראה את זה ואז נעריך האם ניתן לחקות את אותו תהליך במעבדה שלכם ואם לא, מהן הבעיות וכיצד ניתן לפתור אותן? אז ראשית, אם אתה זוכר את תהליך שכפול ה- DNA, מהם המרכיבים שהיו נחוצים? שכפול DNA נמצא בתא באורגניזמים חיים. מרכיבים וכאן אכתוב את האנזימים. מהם הריאגנטים הנדרשים? ומהם האנזימים שנדרשו? מהם הריאגנטים או המרכיבים הנדרשים? כמובן שבאמצע זה היית צריך את ה- DNA לדוגמה. הדנ"א שאתה רוצה לשכפל או ה- DNA או הגן של ההורה שלך, זה מה שאתה צריך קודם כל כי זה מה שאתה רוצה לעשות יותר עותקים מהשני מה שאתה צריך היית צריך פריימרים של RNA אם אני זוכר נכון. אז ראשית, היית צריך מספר רב של פריימרים של RNA, כי אם אתה זוכר את הגדיל המוביל הנדרש 1 פריימר RNA היטב הגדיל השהות דרש מספר רב של פריימרים של RNA מכיוון שהתחלת מאמצע הגדיל מהאיזשהו מקום בין הגדילים. לכן, בכל פעם שהגדיל נפתח, היית צריך להתחיל בפריימר RNA חדש. כל כך הרבה מספר פריימרים של RNA נדרשו. מה עוד היית צריך שהיית צריך את dNTPs חומצות הגרעין החופשיות היו דרושות 4 dNTP. כמובן, למשל, dATP, אדנוזין טריפוספט, היית זקוק לטריפוספט גואנוזין GTP, היית צריך dCTP המצוטט בטריפוספט ואז היית צריך dTTP תימידין טריפוספט. אז, הנוסחה הכללית היא זו, האם הבסיס A, T, G, C המבנה היה 3 O הידרוקסילים החופשיים העיקריים והפוספט, הטריפוספט בחמשת הקצוות הראשיים זה מה שאתה צריך. האם היית צריך עוד משהו או dNTPs פריימרים? לרוב היה צורך במרכיבים האלה והיית צריך הרבה אנזימים. האנזים הראשון שנדרשת היה הליקאז. אז היית צריך חלבון מחייב חד-גדילי לאחר אותו משחק הפולימראזות שהיית צריך 2 פולימראזות למעשה עבור 2 גדילים אם אתה זוכר שלפני כן, כמובן שהיית זקוק לפריימזה של RNA שסינתזה את הפריימרים של ה- RNA כך שהיה צורך ב- RNA primase. אחרי זה היית צריך RNAase כדי להרוס את כל הפריימרים של ה- RNA אז היית צריך DNA ליגאז כדי לתפור את כל ה- DNA המקוטע שנוצר. אז לפחות אלה הם מספר האנזימים שדרשתם ואלו המרכיבים המבנים הכימיים שדרשתם לשכפול ה- DNA בתוך התא. עכשיו, השאלה היא שאם אתה לוקח את כל אלה יחד במבחנה הולכים להצליח האם זה יעבוד בביצוע השכפול. אז אם אנחנו רואים, נניח, זו המבחנה שלך, ושמת קודם כל את DNA המטרה הדנ"א הכפול שלך, זהו ה- DNA הכפול שלך, 5 ראש עד 3 פריים, 3 פריים עד 5 פריים כל בוקר מימן. נמצאים שם עכשיו, הדבר הראשון היה שאתה צריך לפתוח את המסוק הכפול ואתה צריך את ההליקאז. אז היה לנו כאן helikase שעומד להיפתח ולהכין מזלג שכפול ואז צריך לייצב אותו על ידי חלבון SSB. בינתיים הכל טוב. עכשיו מה שאתה צריך, עכשיו אתה צריך את הפריימרים של ה- RNA, בפריימרים של ה- RNA אולי בעזרת האנזים של הפריימזה וזה יתחיל את השכפול. אז זהו ה- RNA שלך שהיה 5 Prime יש לך 3 קבוצת הידרוקסיל פריים בחינם. כאן הפריימר יהיה זה כאשר קבוצת ההידרוקסיל 3 הפריים מספיק טובה. עכשיו, מה שאתה צריך לשכפל אתה צריך את הסיומת הדרושה לך כדי לסנתז את הגדיל המשלים שנעשה על ידי הפולימראז. אז, אתה מוסיף את 2 הפולימראזות עבור 2 גדילים שונים. אז הפולימראז הולך להיקשר לכאן ואז אתה צריך את כל 4 ה- dNTP. אז מתאים בהתאם למה שיש לך על הגדיל הנגדי שהטריפוספט החופשי ייקלט על ידי הפולימראז וזה ימשיך את הסינתזה אותו דבר יקרה כאן. אז תקבל את ה- RNA כך שתסנתז את ה- DNA עליו. אז זהו ה- DNA שלך. זהו ה- DNA שלך, כך שחצי המנה שלך מסתיים ואז תוכל להיפתח יותר ולחזור אחורה. כך תקבל את הגדיל המוביל. ראינו 5 ראש עד 3 פריים שהוא הגדיל המוביל ותוכלו לסנתז ברציפות. הגדיל החדש המחמיא שהוא 5 פריים עד 3 פריים, קבוע כאן בתוספת זו גרסת הגדיל המשתרכת שלך, 3 פריים עד 5 פריים ותסנתז את ה- DNA בשברים. כל הפערים היו במקור תפוסים על ידי פריימרים של RNA שעיכלת שעליך להשאיר על ידי האנזים RNAase. ואז השתמשת בליגאז DNA ליגאז כדי לקבל את הגדיל המשלים המלא, 3 פריים עד 5 פריים, 5 פריים עד 3 פריים בשביל זה. אז, מתוך DNA אחד אתה יכול לסנתז במחזור הראשון עד DNAase בסדר. עכשיו, הדבר הזה אמור להימשך ונמשך במחזור מכיוון שהוספת את כל האנזימים, הם לא הולכים לעצור שם. ואתה צריך יותר כמויות של DNA. אז עכשיו תחשבו על המחזור הבא האם זה יעבוד זה זה וזה ישוכפל עוד יותר מתחת למצב שלכם במבחנה שלכם, אני לא חושב שכן. אני לא חושב שזה יעבוד יותר במחזור הבא. לאחר שהוספת את כל המרכיבים לאותה מבחנה, הבה נראה אם ​​זה יכול להמשיך. הדבר הראשון הוא שהוספת RNAase שם במבחנה שלך. אז גם למחזור השני, אתה צריך פריימרים של RNA עבור גדיל זה ואת הגדיל הזה כל הגדילים אתה בעצם צריך פריימרים של RNA. אז, גם אם מוסיפים את המחזור השני. אז 5 פריים 3 פריים, פתחת את מזלג השכפול השני לגדיל אחד, 3 פריים, 5 פריים, אתה צריך את ראש ה- RNA כאן, אתה צריך את ה- RNA הפריים שם. זו המבחנה שלך שמכילה את כולם כבר. אבל היה לך שם RNAase. אז RNAase למעשה ניתק או הרס את כל ה- RNA בו השתמשת בעבר. אז גם אם תוסיף פריימרים חדשים של RNA האם זה הולך לעבוד? לא, מכיוון שכבר יש לך את ה- RNAase במבחנה שלך, ברגע שתוסיף את הפריימרים של ה- RNA, הם יהרסו. אז כל ה- RNA שיהרוס. ואם ה- RNAase לא קיים, ההרחבות לא יכולות לקרות. הפולימראז אינו יכול להגיב. זאת בעיה מספר 1. הבעיה השנייה היא, אתם מבינים, סינתזתם 1 גדיל חדש, 2 הגדילים החדשים האלה שם. אז, יש לך כמה עותקים של DNA כבר בפתרון שלך. אתה יכול לכתוב את זה כך שיש לך DNA דו-גדילי, 5 ראש עד 3 פריים, 3 פריים עד 5 פריים, והנה שוב יש לך כמה עותקים זהים. אז 5 פריים, 3 פריים, 3 פריים, 5 פריים כמה עותקים צפים בתמיסה שלך ויש לך שם ליגאז DNA אז, הדבר הראשון, מה שיקרה הוא דנ"א ליגאז יתאחד כל מה שיש לך במבחנה. . אז 2 אלה היו מחוברים זה לזה ובמקום לקבל את ה- DNA האמיתי שלך, תקבל כעת גרסה ארוכה יותר של ה- DNA. אז המקוריות שלך אבודה. יתר על כן, אם אתה חושב שגם אם זה יעבור במקום, ללא RNAase אפילו זה יכול לסנתז את הגדילים הבאים, אתה הולך לסנתז את ה- DNAase המקוטע ואת ה- DNAase המקוטע לפני שהם מסונתזים. כלומר, מיד לאחר שהם מסונתזים מיד לאחר יצירתם, הם יכולים ובאופן לא ספציפי להתחבר זה לזה מכיוון שיש לך ליגאז כבר בפתרון שלך. אז כמה בעיות במילים אחרות, אם אתה רוצה לעשות שימוש באותה קבוצה של אנזימים, שימוש באותה קבוצת מרכיבים, שקורה בתא ביולוגי, אתה לא תקבל את ה- DNA המוגבר שלך שלא ניתן לבצע תהליך של שכפול DNA. בצורה חלקה במבחנה ללא התאים החיים. אז זו הבעיה של חיקוי הפולימראז המחקה את שכפול ה- DNA במעבדה. אז מה הדרך החוצה? כיצד תוכל לשנות זאת? איך אתה יכול לגרום לזה לעבוד? אז דבר אחד שאתה צריך לזכור הוא שאתה נמצא במעבדה ואתה עושה את זה במבחנה. אז, יש לך קצת חופש שאין לך בתא חי. לכן, עלינו לחשוב כך ולחשוב מה אנו יכולים לעשות כדי לפתח או לגלות שיטה חדשה כך שהתהליך עשוי לעבוד. אז, אם אתה מסתכל, יש לך בתחילה את ה- DNA היעד שלך דו-גדילי. מה היו הקריטריונים הראשונים? The first criteria were that you need to unfold the DNA at least partially. That is why you needed the enzyme helicase and that is why you needed the enzyme, single-stranded binding protein. Now, think of it can you do this thing in your laboratory? Can you unfold your DNA or the gene in your laboratory or what should be the condition if you want to open them up? You remember we have talked about DNA, DNA denaturation. DNA denaturation means that to a double-stranded DNA would be split into 2 single standard DNA, that is DNA denaturation, So now think of it way, how can you do our DNA denaturation basically means that you have to break all the noncovalent interactions that are present within your DNA, all the hydrogen bonds, all the pie stacking interactions should be broken down. And in your laboratory, what is the tool you have to do it? Very simple, by heat, if you simply heat it up to a little bit higher temperature, we usually do it at 95 degrees Celsius. You do not go to 100 degrees Celsius because in that temperature your solution which usually in water, DNA soluble, very much soluble in water. So most of the work of DNA we do in an aqueous medium, there are other buffers in it, but the medium is aqueous. So it will start boiling at close to 100 degrees Celsius temperature. And so we do not want that. That is why that temperature is kept a little bit less close to 95 degrees Celsius. If you heat your DNA at 95 degrees Celsius, what is going to happen? It is going to break all your noncovalent interactions. So at this stage, it will be broken which includes hydrogen bonding pi stacking and all. So, in other words, your base pairs would be destroyed and you can very much have 2 single-stranded DNA free from each other no interaction at all. So, by the simple trick of heat, you can separate the DNA into 2 single-stranded DNA. Now, of course, you can understand the same condition obviously cannot be used in a cellular system. Because of 95 degrees Celsius temperature inside our cells if you want to increase that temperature. We will all die so, that is what the freedom we have in the laboratory that you can use heat to make the double-stranded DNA into the single-stranded DNA. What is the other advantage in the cell you have opened the DNA or you have opened the gene partially and that is where all the problems were in the lagging strand? Here, you see once you put heat, they are completely separated whole of the double-strand is completely separated not partial separation, complete separation of the double-strand into 2 individual single strands. So, that gives you full freedom of the single strands and now, you do not have the replication fork, they are all open, and as we will see you can understand that it makes the process so simple now. Because of the simple treatment because of this very simple ingredient that is the heat in this case so, since you have opened with the heat, you do not need helicase it is not needed your SSB protein not needed. Now you move on to the next step what else is required? So let us take this strand first. I still call it leading strand and lagging strand which was originally being called in the cell. But they are no longer actually leading stand they are no longer lagging stand they will behave as equal. Now we will see. So if you take this 5 prime to 3 prime Now if you want to make the complementary strand, what do you need? For cells, you needed the RNA primers that were synthesized from the RNA primase. Now in the laboratory, you do not need RNA primers, because we have already learned to synthesize oligonucleotides. So we will use DNA primers instead of the RNA primers. So now we will use DNA primer, in this case, this is only one. So DNA primer, RNA primer is not required for the laboratory technique, because that DNA primers do not exist in our body does short sequences short oligonucleotide sequences of DNA do not present in our body RNA oligonucleotides are present to some extent. So, since you do not require the RNA primers, therefore, RNA primase that enzyme is also not required. Therefore, RNA primers are also not required. So, you see how the process becomes simplified one by one. So, use a DNA primer and now, for the extension of course, you need a polymerase that is needed because the reaction that I have shown that if I am not writing the whole thing again here O P P P triphosphate, triphosphate these 3 prime hydroxyl which is here. So, this is 5 prime, this is 3 prime will react with B 2 O P P P this reaction can be catalyzed or this reaction can be done only by this enzyme polymerase there is no other goal. So, we need the enzyme polymerase and you need all the individual dNTPs that are also required. So, since DNA primary is their DNA polymerase is going there bound and suitably the complimentary DNTP will be picked up and your strand would be synthesized in this direction. 5 prime to 3 prime so, this is the new strand and that you are synthesizing that you have synthesized 5 prime to 3 prime continuous without a break or without any interruption. Now, since you did not use RNA primer here all DNA, so, you need not go any other steps your amplification for this strand is complete. Now, look at the other strand. Another strand was 5, so, this is 5prime to 3 but this is 3 prime to 5 prime all right here, so, that it will be more clear, 3 prime to 5 prime that is this strand, lagging strand 3 prime to 5 prime. Now, that is also free fully. So, in lagging strand in DNA replication in a cell you have seen that RNA primer came was bound in the middle of somewhere because you were half-open there or partially open there. In this case, your strand is fully open. So, and your reaction is always starting from the 5 prime to 3 prime direction, what is the 5 prime to 3 prime direction here? 5 prime to 3 prime. So you are not starting in the middle of somewhere, you are starting at the very end, just like the leading strand. So, you are again, you can use another DNA primer, suitable DNA primer that is suitable for this strand. And then, of course, use the same enzyme. Now you need a polymer is but do you require a different polymer is no. Here is the same thing 5 prime to 3 prime hydroxyls is free for lagging strand since your synthesis was happening in a discreet manner in the middle part or somewhere in the portion of the gene, you had required a different polymerase, in this case, is the same reaction is happening exactly same as here. So, the same polymer is will do it you do not need a different polymerase so, the same polymer is that you have used in the earlier stage will also work here. And the same dNTPs that you have in your solution will be used and you can have a continuous synthesis without any interruption. So, this is your parent's strand, 3 prime to 5 prime and this is what the new strand that you are synthesizing, 5 prime to 3 prime. So, you see both the leading strand and the lagging strand are behaving as equal in a test tube. And since this is happening, you are not creating the Okazaki fragments. Therefore, you do not need the DNA ligase to ligate them, that is not required and since you do not have the RNA primers, you do not need to destroy them. So, the enzyme RNAase is also not required. So, what you do need here is if I now go back and check what I had written initially here and there, you do not need for the laboratory one you do not need the RNA primers. Instead, you need only DNA primer and you need 2 of them, 1 for each strand RNA primers were needed in multiple numbers dNTPs yes these 2 are needed. Enzymes helicase no need single standard binding protein, no need polymerase, you need 1 RNA primers, no need RNAase no need DNA ligase you do not need. So you have come down to a single enzyme that is polymerase for the whole process and a single trick of heat and the ingredient, one extra ingredient that is the DNA primer which you can synthesize. So, that is the beauty of doing this replication process in the test tube. Now basically what you can have you can have your test tube you can take all the dNTPs for you can use a single polymerase. And you need the DNA primers 2 DNA primers and you will have your amplification as you move on. So, that is the brilliant development of this method that you have simplified such a complicated process into a really doable thing. Now, what another requirement you have you have to use heat for here right and then only you will get your amplifier DNA, more number of DNAase number of copies of DNA you are going to get there is still a problem. Do you see the problem? If you use all the 4 dNTPs if you use the DNA primers if you use the polymerase and you have your target DNA, double-stranded DNA. Actually, still, you are not going to get your amplified pieces of stuff. למה? There is a key problem. The problem is you are using heat close to 95 degrees Celsius. And at this temperature, obviously, we are breaking the DNA. We are denaturing the DNA at the same time, you will denature the enzyme Also the polymerase we denatured at high temperature so polymerase is the protein and the protein functions when it is in tertiary structures coiled form 3 dimensional form. I will show you the structure of polymerase briefly in a just very soon. So, but any protein when it functions enzymes they are all in the coil form folded confirmation, and those confirmations are formed along with some covalent interactions, mostly the noncovalent interactions, hydrogen bonding electrostatic interactions, hydrophobic interactions, at high temperature. Those will all be gone and your protein will be dead polymerase will be as good as inactive. So, at that temperature, your polymer is cannot work and that was a key problem that had been sustained for a long time and people were searching to find a solution, what can be done? Can this be achieved at all? So, finally, and this is again another very important discovery is that they have isolated one kind of polymerase is that is known as Taq polymerase. This is a polymerase that can sustain high temperatures because this polymerase was isolated from the microorganisms present in hot springs so hot springs have a high temperature close to boiling temperature. But still, there are many microorganisms living their thermophilic bacteria we call them or thermostatic microorganisms, thermophilic microorganisms, there is life still in the hot springs. So what they have done, they have and of course, since there is life, they were having their cell divisions as well to the must-have polymerase. We have isolated those polymerases and that is known as Taq polymerase. I will show you why Taq, so the Taq polymerase can sustain high temperature and now your problem is solved. So, if you now use these in your laboratory with the dNTPs. With the DNA primers and the newly found polymerase high temperature you are going to get your amplification of DNA. So finding out Taq polymerase was a crucial part of this whole method development. So now I will show you how is it done. So the whole of the PCR is done inside a machine since a very small machine benchtop. You can put it on your table, a small machine which can be programmed. So, you can see the buttons here, it can be fully programmed all the steps it can be preprogrammed so that it will go on automatically. Here is a sample chamber where the things are done. And typically use a very small quantity of volume less than 200 microliters most of the timeless than 200 microliters, so the test tubes. I was talking about are actually the PCR tubes in this model of sizes were quite a small size. So everything is done here. And the key steps are the key things that you need here is of course, you need the DNA sample that you have isolated and that is going to act as your template. second is you need the polymerase Taq polymerase number 3, you need the oligonucleotides which we call primers, so 2 DNA primers 4 is all the 4 dNTPs dATP, dGTP, dCTP and dTTP these are the 4 dNTPs units. And lastly, you remember when we make a DNA hybridization we always had to use salt because phosphates that are present in the backbone will rebuild each other. So in order to overcome that, we always use either sodium chloride or magnesium chloride. And the second reason you need to use a magnesium chloride is that the polymerase uses as magnesium chloride as its cofactor. So our fifth thing is you need magnesium chloride buffer solution. So next we will see how the steps actually work. תודה.

Log in to save your progress and obtain a certificate in Alison’s free Biomolecules - DNA Replication and Sequencing online course

Sign up to save your progress and obtain a certificate in Alison’s free Biomolecules - DNA Replication and Sequencing online course


From a Pink Squiggle to the Human Genome Project

I n 1994, a Swiss biologist named Pascal Gagneux began a Ph.D. program in zoology. His research plan was to stalk populations of wild chimpanzees in Cote d’Ivoire and Mali. Specifically, Gagneux was in search of chimp nests in forest trees. After he figured out where the chimps slept, he’d wait until they left during the day to search for food before climbing trees to collect their hair.

Gagneux’s aim was to document genetic diversity in our nearest, dearest, and critically endangered relatives. In order to see what made one chimp different from another, and one population of chimps different from the next, he needed to be able to take that hair he’d collected, extract DNA from its follicle, and quickly multiply the DNA. If Gagneux had embarked on his quest just a few years earlier, that crucial last step, the multiplying, wouldn’t have been possible. But thanks to a then-new scientific technique—and a fortuitous discovery in the hot springs of Yellowstone National Park two decades earlier—Gagneux was able to learn that chimpanzees have much more genetic diversity than humans. “There’s more diversity in one social group of chimpanzees than in all 7 billion humans on the planet,” he said.

DIVERSE CHIMPS: Polymerase chain reaction, a process that takes a single scrap of DNA and churns out copy after copy, has led to discoveries like chimps’ remarkable genetic diversity. Julie Larsen Maher/Wildlife Conservation Society

Because the numbers of wild chimps are rapidly dwindling, that knowledge might have been completely lost were it not for the conveniently timed invention of the polymerase chain reaction, or PCR, a process that allows scientists to take a single scrap of DNA and churn out copy after copy with all the ease of stuffing paper into a Xerox. PCR, introduced in 1983, made Gagneux’s work possible.

In fact, PCR is one of the great technical achievements of our time. Many of the mapping techniques used in the Human Genome Project relied on PCR, and it’s helped do everything from identify a previously unknown bacteria that can cause a more-serious form of Lyme disease to aid doctors in screening patients for hereditary diseases like Tay-Sachs and cystic fibrosis. Its inventor, Kary Mullis, won the Nobel Prize for Chemistry in 1993.

But the success of PCR and its standing as one of the most important scientific advances in the history of molecular biology depends upon the discovery, in the mid-1960s, of a pinkish-orange squiggle of a bacterium in a hot spring at Yellowstone National Park. The two men who discovered this bacterium didn’t go searching for something that could be used for DNA replication—or anything else, for that matter. They were just curious. And that curiosity just happened to change the world.

T. aquaticus would help spark a genetic revolution more than a decade later.

In the mid-1960s, when Hudson Freeze was an undergrad at Indiana University, he was, he said, likely the only guy in his dorm who didn’t smoke dope. “I was a classic nerd,” he said. (He even worked in one of the university’s labs while in high school.) Despite his interest in science, he describes himself as drifting through life. One afternoon, he saw a lecture by a professor named Thomas Brock that intrigued him.

Brock’s research centered on microbial ecology: He was interested in how photosynthetic microbes worked outside of a laboratory setting and how photosynthesis changed with temperature. Hot springs, with their variety of relatively stable temperature ranges, seemed like a great place to do that.

Your DNA Is Nothing Special

Who’s your daddy? It’s a fair question. A meta-study published in 2006 by a University of Oklahoma anthropology professor estimated that 30 percent of men who have low paternity confidence about a child were justified in their suspicions. Even among. קרא עוד

So in the summer of 1966, armed with a grant from the National Science Foundation, Brock and Freeze set out for Yellowstone to collect bacteria that thrives in hot springs. It was the first time Freeze had ever left Indiana. He spent the summer gathering, grinding, and extracting bacteria samples to ship back to Brock’s lab. That fall, Brock paid Freeze $2 an hour to put the samples from the hot springs in culture media, at different temperatures, to see what they would grow. One day, in a sample set to 176 degrees Fahrenheit (80 degrees Celsius)—a temperature at which Brock, Freeze, and the rest of the world assumed that nothing could survive—Freeze found the pink filaments of a previously unknown bacterium that Brock would later name Thermus aquaticus—literally, “hot water.” Brock would go on to find the bacterium in lots of different hot water environments—including the University of Indiana’s own plumbing system.

Freeze remembers feeling disappointed with the new creature’s name. “That’s lousy. Hot water? You can be more creative than that.” But he finished his work for Brock, graduated, and went on to another school to work on his Ph.D. Beyond the curiosity of its ability to survive at such high temperatures, he didn’t see much use for the bacterium he’d helped discover. “Some people from Cincinnati who worked for Proctor and Gamble came to see if there was any use for the organism. I think they wanted to put it in Tide,” he said. “But I didn’t think it would amount to anything. I just thought it was cute.”

After Freeze left Indiana, his initial sample of T. aquaticus, taken on Sept. 5, 1966 from Yellowstone’s Mushroom Spring and designated YT-1, went to the American Type Culture Collection in Washington, D.C. And that was where it would help spark a genetic revolution more than a decade later.

You can exponentially multiply the copies of your target DNA. In a matter of hours, you can create millions.

In the early 1980s, many researchers were looking for ways to make more copies of DNA faster. Say you have a drop of blood left at a crime scene and you want to see if the DNA matches that of a suspect. DNA is fragile stuff and that drop of blood probably won’t contain enough, on its own, to allow you to sequence it and make a match. But if you can take the DNA and make many, many copies of it, you’ll have enough to work with. Think about a small animal, like an ant. You might not notice just one ant—but if there were 1,000, they’d be a lot more visible.

The polymerase chain reaction makes copies of DNA and it doesn’t, strictly speaking, need T. acquaticus in order to work. Instead, what it needs is a polymerase, a type of enzyme involved in building and repairing DNA. Scientists take DNA from an organism that contains a segment of DNA they want to copy, and mix it with polymerase, a bunch of loose nucleotides to build DNA from, and short strands of nucleotides, called primers, that show the polymerase where to start building and where to stop. Then, it’s just a matter of heating and cooling. Heat the mixture up, and the DNA separates into two strands. Cool it down and the primers latch on. Heat it up again, and the polymerases go to work, turning loose nucleotides into DNA copies. If you run the cycles of heating and cooling over and over and over, you can exponentially multiply the copies of your target DNA. One becomes two. Two becomes four. Four becomes eight. In a matter of hours, you can create millions.

That was the basic concept that Mullis came up with, but getting it to work in a commercial way was a group effort. Norman Arnheim, a scientist who, together with Henry Erlich, also worked on the early development of PCR, says that the initial system was clunky and fussy. Heat deactivated the polymerase. So, in every cycle, scientists would have to open each test tube up and add more polymerase, at just the right temperature, so it could work but not die. “You’d have to do this forever. It was excruciatingly painful,” he says.

To get around the problem, Mullis’ team started looking for a polymerase that could survive under high heat. They found it in Freeze and Brock’s YT-1 sample. In 1989, מַדָע magazine named the polymerase from T. aquaticus “Molecule of the Year.”

THE HEAT IS ON: The success of PCR depended on a polymerase that could survive under high heat. Scientists found it in a bacterium that thrived in a sizzling Yellowstone hot spring (above). ויקיפדיה

And that was when Freeze found out what had happened with his old discovery. The rights to the PCR technique sold to Hoffman-LaRoche Pharmaceuticals for some $300 million, but T. aquaticus itself was never patented. Most scientists who do basic research don’t get rich off it. Turning a profit was never their goal. “It doesn’t work that way in science,” Freeze said. Instead, they’re out to further human knowledge and make that knowledge available to others. Without them, the inventions that לַעֲשׂוֹת make money could never happen.

Today, Freeze is the director of the human genetics program at the Sanford Burnham Prebys Medical Discovery Institute in La Jolla, California, making him one of the millions of scientists who uses PCR almost every day. “Here I am using the fruits of this discovery and I’m actually improving lives with it,” he said. “That makes the whole project, and by that, I mean my life in science, really meaningful.”

Gagneux, the chimp geneticist, is one of Freeze’s colleagues and considers the older man a giant in his field. Despite this, Gagneaux was surprised to learn, years after they met, about the contribution Freeze had made to science. That’s the other thing about basic science—not only does it not make scientists rich, it often doesn’t even make them famous. Basic science is necessary, but it’s also frequently overlooked.

In the summer of 2014, on a family vacation to Yellowstone, Gagneux went searching for the hot spring where T. aquaticus was discovered. The area was beautiful, he said, all these bubbling pools in a riot of colors, but also quiet and anonymous. There’s no sign alerting visitors about its history. “I was happy to think I saw that pool,” Gagneux said. “I sent Hud an email and told him, ‘I think I found it.’ ”

Maggie Koerth-Baker is the senior science reporter for FiveThirtyEight.com. עבודתה הופיעה ב The New York Times Magazine, The Atlantic, ופרסומים אחרים.

This story was commissioned by the Science Philanthropy Alliance as part of its Science to Society series, illustrating the importance of basic scientific research.


שאלות נפוצות

Q 1. What is the purpose of a polymerase chain reaction?

It is a quick and inexpensive method of amplifying small segments of DNA, which is essential for molecular and genetic analyses. Every study of isolated DNA pieces needs to undergo polymerase chain reaction amplification.

Q 2. What happens in a polymerase chain reaction?

A segment of DNA is amplified using PCR. To do so, the sample is heated to denature the DNA. By denaturing means separating DNA segments into two pieces of single-stranded DNA. The enzyme Taq polymerase synthesizes the DNA to build to new strands resulting in the duplication of two original DNA. each of the strands is used to create two new copies – the cycle can be repeated 40 times making it possible to build a billion copy of the original DNA segment. The entire process would only take a few hours to complete.

Q 3. What is needed for PCR?

To be able to perform PCR, the following is needed:
1. DNA sample
2. ddNTPs (free nucleotides)
3. DNA primers
4. פולימראז DNA

Q 4. How is the PCR used to diagnose?

It is used to count the number of DNA/copies of a gene present in a given sample.
It is used to find out the viral load of HIV in patients suffering from AIDS.
– It is helpful in determining the number of cancerous cells that are remaining in a cancer patient undergoing treatment.

Q 5. Is real-time PCR quantitative?

Real-time PCR is also called quantitative PCR. It is based on the method that includes amplification of the target DNA sequence and quantifying the concentration of DNA species in the reaction.

Q 6. What is the end result of PCR?

The end product of the polymerase chain reaction is a brand new DNA strand with a double-stranded DNA molecule.

Q 7. What happens at 72 degrees in PCR?

The 72 degrees’ temperature is the optimum for Taq polymerase. Once it reaches this temperature, the extension process begins. Taq polymerase works off the primers and will generate a new strand of DNA which results in double-stranded DNA.

Q 8. How many types of PCR are there?

Not all PCRs are the same. You will be surprised to know that there are many types of PCR and the most common ones are the following:
Real-time PCR/Quantitative PCR/qPCR – It uses a fluorescent dye to tag the molecules of DNA. it is used to detect and quantify PCR products in real-time.
Multiplex PCR – It multiplies multiple fragments in a single sample of DNA using a number of primers.
reverse-transcriptase – The purpose is to create complementary DNA by means of reverse transcribing RNA to DNA with the help of reverse transcriptase.
Hot start PCR – Heat is used to denature antibodies that are used for Taq polymerase inactivation.
Nested PCR – Once the initial PCR cycle is done, another PCR is done but this time with the use of a new primer nested within the original primer. Thus, the term nested PCR. The reason for doing so is to reduce the risk of unwanted products.
Assembly PCR – Overlapping primers are used to amplify longer fragments of DNA.
Long-range PCR – A longer range of DNA is formed with the help of a polymerase mixture.
In situ PCR – It is a type of PCR that takes place in the cells or fixed tissue on a slide.
Asymmetric PCR – A single stand of target DNA is amplified.

Q 9. How accurate is a polymerase chain reaction?

The polymerase chain reaction is a highly sensitive procedure. the sensitivities range from 61% to 100%. The specificities range from 11% to 100%.

Q 10. What diseases can PCR detect?

There are different types of diseases that can be detected using PCR such as:
1. Hepatitis
2. HIV
3. Human papillomavirus (causes genital warts and cervical cancer)
4. מָלַרִיָה
5. גַחֶלֶת
6. Epstein-Barr virus in people with glandular fever

Q 11. What do PCR primers do?

They are short fragments of single-stranded DNA, around 15 to 30 nucleotides long complementary to sequences of DNA that flank to the target region. What does a PCR primer do? It provides a free 3’ –OH group where DNA polymerase can easily add dNTPs.

Q 12. Why is PCR important?

A polymerase chain reaction is important as once DNA is amplified it can be used in various laboratory procedures and clinical methods. Examples are fingerprinting of DNA, diagnosis of various genetic disorders, detecting the presence of bacteria and viruses such as in the case of people with HIV/AIDS.

Q 13. What enzyme is used for PCR?

An enzyme is used to complete the polymerase chain reaction. The two enzymes used are DNA polymerase enzyme and Taq enzyme. The DNA polymerase enzyme is used to create new strands of DNA with the use of existing strands as templates.

Q 14. What are the 4 steps of PCR?

The polymerase chain reaction is composed of four primary steps:
1. The first step is denaturation using heat.
2. The second step is annealing the primer to a specific target sequence of DNA.
סיומת
3. End of the first cycle.

Q 15. Who first got the idea of a polymerase chain reaction?

The polymerase chain reaction is a product of the inventive mind of Kary B. Mullis. He invented this procedure in 1985 which paved a way to scientists making millions of copies of scarce DNA samples.

Q 16. Why it is called real-time PCR?

It is called real-time PCR primarily because it monitors the progress of polymerase chain reaction in real-time. only a small amount of PCR product can be quantified during the procedure.

Q 17. Is the RT PCR expensive?

The RT PCR test is an expensive procedure. it is a nuclear-derivative way of identifying the presence of specific genetic materials from a particular pathogen such as the virus. Why it is expensive? It is primarily because the equipment and resources used to run the test are scarce.

Q 18. What is the difference between real-time PCR and PCR?

The difference between traditional PCR and real-time PCR is that the former has advanced from detection at the end-point of the reaction to detection. On the other hand, the latter enables the detection of PCR amplification during the early stage of the polymerase chain reaction.