מֵידָע

האם פוטנציאל הזטה של ​​חלקיק ננו לוקח בחשבון בדרך כלל את מטען הליגנד?


לדוגמה, אם היה לי חלקיק קוונטי עם חלקיקים מצומדים פפטידים המכוסים במערכות פוליארגינין.

האם לוקליזציה של מטען שלילי מארגינין תשנה את פוטנציאל הזטה של ​​מכלול ה- np-peptide הכולל?

או שמא למערכת הפוליארגינין יש שכבה נייחת משלה ופוטנציאל הזטה שלה נפרד מזה של QD? במיוחד אם הוא משתרע מחוץ למישור ההחלקה של ה- QD?


בקשה זו דורשת עדיפות לבקשת פטנט ארעית מס '62/515,474 שהוגשה ביום 5 ביוני 2017, בקשת פטנט ארעית מס' 62/564,129 שהוגשה ב -27 בספטמבר 2017, ובקשת פטנט זמנית לארה"ב מס '62/664,045 הוגשה. ב -27 באפריל 2018, שכל אחד מהם משולב בהתייחסות בשלמותו כמפורט במלואו כאן.

הפניה לרשימת רצפים

קובץ טקסט קריא מחשב, בשם "17-116-WO-PCT Sequence Listing_ST25.txt" שנוצר ב- 5 ביוני 2018, עם גודל קובץ של 260 KB, מכיל את רשימת הרצפים של יישום זה ומשולבת בזאת על ידי הפניה ב- שלמותו.

תחום הגילוי

הגילוי הנוכחי מספק נמלי בטוח גנומיים (GSH) לטיפולים גנטיים בתאי גזע אנושיים וחלקיקים מהונדסים למתן טיפולים גנטיים ממוקדים. ניתן להשתמש ב GSH ו/או חלקיקים הנלווים לטיפול בבטחה וביעילות במגוון מחלות גנטיות, זיהומיות וממאירות.

רקע הגילוי

לטיפול גנטי ספציפי לחולה יש פוטנציאל רב לטיפול במחלות גנטיות, זיהומיות וממאירות. לדוגמה, הוספת גנים בתיווך רטרו-וירוס לתאי גזע המטופויאטיים (HSC) ותאי גזע המטופויאטיים ותאי אבות (HSPC) הוכיחה תוצאות מרפאות למספר מחלות גנטיות במהלך 10 השנים האחרונות כולל פגמים חיסוניים תורשתיים (למשל, X-linked ו- adenosine deaminase חוסר חיסוני משולב חמור (SCID)), המוגלובינופתיה, תסמונת וויסקוט-אולדריך ולוקודיסטרופיה מטכומומטית. בנוסף, גישה טיפולית זו שיפרה גם את התוצאות לאבחנות פרוגנוזה גרועות כגון גליובלסטומה. השימוש ב- HSPC האוטולוגי המתוקן בגן, או "עצמי", מבטל את הסיכון לתגובות חיסוניות של מארח השתל, ושולל את הצורך בתרופות דיכוי חיסוני. עם זאת, יישום יעיל של טיפול גנטי ב- HSPC עומד בפני מספר אתגרים מרכזיים. המצב העדכני ביותר כולל הסרת תאים מהמטופל באמצעות אספיריית מח עצם או דם היקפי מגויס, מיון אוכלוסיה בתפזורת זו ל- HSPC אוטולוגי על ידי בחירה חיסונית של תאים המבטאים את סמן פני השטח CD34, ולאחר מכן טיפוח תאים אלה בנוכחות. של ציטוקינים ווקטור הרטרו -וירוס הטיפולי שצוין לפני הקציר. ניהול מחדש של תאים למטופל עשוי לדרוש התניה cytoreductive כדי לאפשר engraftment של התאים המתוקנים הגן. נכון לעכשיו, רק מרכזים עם מתקנים התואמים שיטות ייצור טובות (GMP) והתשתית לתמוך בהם מסוגלים לנהל מוצרי תאים שעברו שינוי גנים. בעוד שפותחה פלטפורמת ייצור פשוטה לאוטומציה של תהליך זה בטביעת רגל קטנה וניידת, כמויות מוגבלות מאוד של וקטורים טיפוליים זמינים המשיכו ליצור צוואר בקבוק משמעותי לשימוש נרחב בטכנולוגיה.

בנוסף לאתגר לייצר כמויות וקטוריות טיפוליות מספיקות, קיים סיכון ידוע לגנוטוקסיות ומגבלות אחרות הקשורות לשימוש בווקטורים ויראליים להעברת גנים. לדוגמה, הסיכונים לגנוטוקסיות מעידים על התפתחות ממאירות עקב מוטגנזה הכנסת מטופלים המטופלים בטיפול גנטי HSPC. תופעת לוואי שלילית זו נובעת מהאופי האקראי למחצה של העברת טרנסגנים בתיווך רטרו-ויראלי לגנום התא המארח. חוסר ויסות של גנים סמוכים על ידי רצף הטרנסגן שהוכנס היה הבסיס המולקולרי להתרחבות המשובטים והטרנספורמציה הממאירה שנצפו אצל חלק מהחולים בטיפול גנטי, אך אינטראקציות הדדיות בין הטרנסגן שהוכנס לבין ההקשר הגנומי שמסביב יכולות לגרום גם לנחתה ​​או השתקה של טרנסגנים, ולהפחית השפעות טיפוליות . מגבלות אחרות הקשורות לשימוש בווקטורים ויראליים מסוימים כוללות אינדוקציה של תגובות חיסוניות, ירידה ביעילות לאורך זמן בתאים המתחלקים (למשל, וקטורים הקשורים ל- adeno), חוסר יכולת למקד כראוי סוגי תאים נבחרים in vivo (למשל, וקטורים רטרו-ויראליים), וכפי שצוין, חוסר יכולת לשלוט באתר ההכנסה ומספר ההכנסות (למשל, וקטורים lentiviral).

בחמש השנים האחרונות ראו פיצוץ בעריכת גנים אלטרנטיבה בטוחה יותר להעברת גנים בתיווך רטרו-וירוס, המתאפשרת על ידי פיתוח RNA מדריך מתוכנן וגרעינים שמכוונים לרצפי DNA ספציפיים ויוצרים כצפוי הפסקות גדילה כפולה של DNA (DSB) ב- רצף ממוקד. עד כה, המתחמים הניתנים לתכנות היו היעילים ביותר במתן טיפולים מבטיחים כאשר יש צורך בהסרה או השתקה של גן בעייתי (כלומר יצירת מוטציה של אובדן תפקוד). הסיבה לכך היא ש- DSB מתוקנים בדרך כלל על ידי הצטרפות קצה לא הומולוגית מועדת לשגיאה (NHEJ) וכתוצאה מכך הוספות ומחיקות oligonucleotide באתר DSB.

לצורך הוספה או תיקון גנים של מוטציה ספציפית, נדרש תיקון פחות מכוון הומולוגי (HDR) של ה- DSB. במצב זה, יש להעביר במשותף מטען מורכב יותר הכולל את ה- RNA המדריך והגרעין, כמו גם תבנית תיקון מכוונת הומולוגיה. הוכחת תפיסה לגישה זו הודגמה ב- HSPC אך גם נדרשה אלקטרופורציה טנדמית של כמה מרכיבי עריכת גנים ואחריה התמרה עם וקטורים ויראליים שאינם משתלבים, במיוחד וקטורים ויראליים (rAAV) רקומביננטיים המסופקים על ידי אדנו כדי לספק תבניות DNA, או electroporation בו זמנית של ריכוזים מוגדרים של רכיבי נוקלאז מהונדסים עם תבנית אוליגונוקלאוטיד חד גדילית בריכוז תאים שצוין. יתר על כן, כל תבנית תיקון המכוונת ל- RNA, גרעיני נוקלאז ותכשיר הומולוגיה הייתה חייבת להיות מתוכננת באופן ייחודי עבור כל יעד גנטי שצוין, ודורשת הערכה נפרדת של מסירה, פעילות וספציפיות בשורות תאים וב- HSPC.

לפיכך, למרות שהיו הרבה פריצות דרך מרגשות ביכולת לבצע טיפולים גנטיים באתרים ספציפיים בתוך הגנום, המחסור המתמשך בכלי אספקה ​​בטוח וחזק הפריע לתרגום הקליני של מערכות עריכת גנים, בפרט, עם HSPC.

הרעיון של נמל בטוח גנומי (GSH) לשינוי גנטי הוצג לראשונה בשנת 2011 על ידי Papapetrou ועמיתיו (Nature Biotechnology. 2011 29 (1): 73-8). הקריטריונים העיקריים המוצעים להגדרת אתר GSH הם (1) היכולת להכיל חומר גנטי חדש עם, (2) פונקציה ניתנת לחיזוי ו (3) ללא שינויים שעלולים להזיק בפעילות הגנומית של תאי המארח. היתרון בזיהוי מוקד כזה יפשט מאוד את מאמצי הפיתוח לגישות תוספת גנים ממוקדות. כמה לוקוסים הוערכו בגנום האנושי, אך עד כה לא זוהו אתרי GSH מאומתים בתום לב העונים לקריטריונים לעיל. Papapetrou et al., Mol. תר. 2016 24 (4): 678-84.

תקציר הגילוי

הגילוי הנוכחי מספק התקדמות משמעותית ביכולת לבצע טיפולים גנטיים במגוון מחלות גנטיות, זיהומיות וממאירות על ידי מתן זיהוי של נמלי בטוח גנומיים (GSH) בתוך תאי גזע המטופויאטיים (HSC) ותאי גזע המטופויטיים ותאי אבות (HSPC). בהתגלמויות מסוימות, ה- GSH זכאי בנוסף למקומות הנמל הבטוחים האוניברסליים של HSC, כפי שמתואר בפירוט נוסף כאן.

הגילוי הנוכחי מספק גם חלקיקים שנועדו במיוחד לספק את כל הרכיבים הנדרשים לעריכה גנטית, למשל, באתרי GSH. חלקיקי הננו יכולים לשמש לטיפולים בהם יש צורך במוטציה של אובדן תפקוד, אך חשוב מכך, יכולה לספק גם את כל המרכיבים הדרושים להוספת גנים או לתיקון של מוטציה ספציפית. הגישות המתוארות הן בטוחות (כלומר, ללא רעילות מחוץ למטרה), מהימנות (כרומטין תאי GSH ממוקד נגיש ומתאים להוספת קלטות טיפוליות), ניתנות להרחבה, קלות לייצור, סינתטיות, plug-and-play (כלומר אותו בסיס בסיסי ניתן להשתמש בפלטפורמה לאספקת חומצות גרעין טיפוליות שונות), ותואמות למתן קל in vivo (באמצעות, למשל, מזרק).

התגלמויות מיוחדות כוללות חלקיק ננו עם רכיבים המספקים מוטציה ממוקדת של אובדן תפקוד. התגלמויות אלה כוללות אלמנט מיקוד (למשל, מדריך RNA) ורכיב חיתוך (למשל נוקלאז) הקשור לפני השטח של החלקיק. בהתגלמויות מסוימות, אלמנט המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד ו/או אלמנט החיתוך מצומדים אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול ורכיב החיתוך מקושר לאלמנט המיקוד ליצירת קומפלקס ריבונוקלאופרוטאין (RNP). רכיב המיקוד מכוון את רכיב החיתוך לאתר ספציפי לחיתוך ולתיקון NHEJ.

התגלמויות מיוחדות כוללות חלקיק ננו עם רכיבים המספקים מוטציה ממוקדת של רווח תפקוד (למשל, הוספת גן או תיקון). בהתגלמויות מסוימות, התגלמויות אלה כוללות חלקיק מתכת (למשל חלקיק זהב) הקשור לאלמנט מיקוד, אלמנט חיתוך, תבנית תיקון מכוונת הומולוגיה ורצף DNA טיפולי. רכיב המיקוד מכוון את רכיב החיתוך לאתר ספציפי לחיתוך, תבנית התיקון המכוונת להומולוגיה מספקת תיקון HDR, שבו לאחר תיקון HDR הוכנס רצף ה- DNA הטיפולי לאתר המטרה. יחד, ניתן להתייחס לתבניות תיקון המכוונות להומולוגיה ולרצפי DNA טיפוליים כתבניות תורמות. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד ו/או רכיב החיתוך מצומדים אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול ורכיב החיתוך מקושר לאלמנט המיקוד ליצירת קומפלקס ריבונוקלאופרוטאין (RNP). בהתגלמויות אלה, מתחם ה- RNP קרוב יותר לפני השטח של חלקיק הננו מאשר חומר תבנית התורם. תצורה זו מועילה כאשר, למשל, רכיב המיקוד ו/או רכיב החיתוך הם ממוצא חיידקי. הסיבה לכך היא שאנשים רבים שעשויים לקבל חלקיקים המתוארים במסמך זה עשויים להיות בעלי חסינות קיימת כנגד רכיבים שמקורם בחיידקים, כגון רכיבים העריכים של גנים הנגזרים. הכללת רכיבי עריכת גנים שמקורם בחיידקים בשכבה פנימית של חלקיק הנוסח במלואו מאפשרת למרכיבים שאינם נגזרים מחיידקים (למשל תבניות תורם) להגן על רכיבים הנגזרים מחיידקים (למשל רכיבי מיקוד ו/או חיתוך) מפני מערכת החיסון של המטופל. מערכת. זה מגן על הרכיבים הנגזרים מחיידקים מפני התקפה וגם מונע או מפחית תגובות דלקתיות לא רצויות נגד חלקיקי התרופה לאחר הניהול. בנוסף, הדבר עשוי לאפשר ניהול חוזר של החלקיקים in vivo ללא הפעלה על ידי התגובה החיסונית המארחת.

התגלמויות מיוחדות משתמשות בעריכת גנים של CRISPR. בהתגלמויות מסוימות, עריכת גנים של CRISPR יכולה להתרחש באמצעות RNA מדריך CRISPR (crRNA) ו/או נוקלאז CRISPR (למשל, Cpf1 (המכונה גם Cas12a) או Cas9).

התגלמויות מיוחדות מאמצות תכונות המגבירות את היעילות ו/או הדיוק של HDR. לדוגמה, ל- Cpf1 יש crRNA יחיד קצר וחותך את DNA המטרה בצורה מכווצת עם 5 ′ 2-4 נוקלאוטיד (nt) תלויים הנקראים קצוות דביקים. קצוות דביקים נוחים ל- HDR, קים ואחרים. (2016) נט ביוטכנול. 34 (8): 863-8. יתר על כן, יש לשחרר תבניות תורמים מהחלקיקים לפני שהגנום יחתך על ידי ה- RNP כדי לקדם HDR. בהתאם לכך, התגלמויות מסוימות המתגלות כאן תבניות התורמים נמצאות רחוק יותר מפני השטח של החלקיקים מאשר רכיבי מיקוד ורכיבי חיתוך. הגילוי הנוכחי גם מצא במפתיע כי אספקה ​​של רכיבי עריכת גנים על חלקיקי זהב מגבירה את היעילות ו/או הדיוק של HDR. בהתאם לכך, התגלמויות מסוימות מספקות רכיבי עריכת גנים תוך ניצול חלקיקי זהב.

בהתגלמויות מסוימות, ניתן להשתמש במולקולות מיקוד כדי למקד את חלקיק הננו לתא ספציפי כך שניתן לשלוט בפעילות של מערכת עריכת הגנים באופן מרחבי או זמני. לדוגמה, הפעילות והיעד של מערכת עריכת הגנים עשויה להיות נשלטת על ידי מולקולת מיקוד המספקת את החלקיק הנלקטי לתאים ממוקדים. בהתגלמויות מסוימות, מולקולת המיקוד יכולה לכלול תחום מחייב נוגדנים הקושר CD34. בהתגלמויות מסוימות ניתן להשתמש בזוגות של מולקולת מיקוד, למשל, תחום מחייב נוגדנים הקושר CD34 ותחום מחייב נוגדנים הקושר CD90.

תיאור קצר של מספר תצוגות הציורים

רבים מהרישומים המוגשים כאן מובנים טוב יותר בצבע. המבקש רואה את גרסאות הצבעים של הציורים כחלק מההגשה המקורית ושומר לעצמו את הזכות להציג תמונות צבע של הציורים בהליכים מאוחרים יותר.

תאנה. 1. סכמטי המראה את העיצוב והרצף של מקבצים מקובלים ומרווחים של חזרה קולית קצרה (CRISPR) RNA (crRNA) (SEQ ID NO: 244) ותבניות הומולוגיה (HT) (מזהות SEQ: 247, 248) לנמל בטוח גנומי (GSH) מיקום (מספרי מזהה SEQ: 242, 243, 245, 246) כדי לאפשר עריכת גנום ממוקד בתוך תאי גזע המטופויאטיים (HSC) ותאי גזע המטופויאטיים ותאי אבות (HSPC).

תאנה. 2. עקבות של תוצאת רצף של סנגר המציגה מוטציה באתר יעד אחד של GSH בתאי K562 (מספר מזהה SEQ: 249 ו -250).

תאנה. 3. סכמטי המראה את העיצוב והרצף של crRNA (SEQ ID NO: 253) ותבנית תיקון המכוונת להומולוגיה (המכונה כאן גם תבנית הומולוגיה (HT או HDT)) (מזהה SEQ: 256, 257) למיקום GSH שני (מספרי מזהה SEQ: 251, 252, 254, 255) בתוך HSC ו- HSPC אנושי.

תאנה. 4. שני אתרי GSH (SEQ ID NO: 258, 259) בתוך הגן CCRS האנושי בתוך כרומוזום 3p21 יחד עם crRNA (SEQ ID NO: 260) ו- HT (SEQ ID NO: 261, 262) עבור גדיל שאינו מטרה ויעד. מטרת בחירת CCR5 הייתה לאמת את הננו -פורמולציה. מוטציה ידועה באופן טבעי בגן CCR5 הופכת את תאי הדם של האדם לעמידים בפני זיהום HIV. לצורך הגילוי הנוכחי, אתר זה סיפק אמצעים להשוות בין נוקלאזות Cas9 ו- Cpf1 ישירות מכיוון שיש רצף DNA ליד האתר של מוטציה טבעית זו המכיל אתר חתך זהה הן ל- Cpf1 והן ל- Cas9. המוטציה של PAM בתבנית ההומולוגיה של גדיל היעד מנוטרת, מודגשת ומתוחתקת.

תאנה. 5. סכמטי של תוכנית הייצור המוקדמת של חלקיקי זהב (AuNPs), פיגום משלוח סינתטי הניתן להרחבה עם תאימות מבוססת in vivo.

תאנה. 6. גודל AuNP קובע את מסלול הרקמה/חיסול היעד בבני אדם.

איורים. 7A-7D. סכמטים המתארים AuNP למופת הקשורים לכל רכיבי עריכת הגנים הנדרשים להוספת ו/או תיקון גנים. (איור 7 א) תיאור של AuNP למופת המוגדר עם כל המרכיבים להוספת גנים בתוך GSH. המרכיבים המתוארים כוללים crRNA, נוקלאז Cpf1 ו- ssDNA כדי לספק רצף חומצה גרעינית טיפולית (למשל גן או חלק מתוקן שלו). ההתגלמות המתוארת באיור. 7A כולל בנוסף מולקולת מיקוד (למשל תחום מחייב נוגדנים או aptamer). (איור 7 ב) ייצוג סכמטי של תהליך סינתזה ליצירה וטעינה של AuNP עם רכיבי עריכת גנים למופת. (איור 7 ג) סכמטי של AuNP "שכבתי" מנוסח שניתן להשתמש בו לאספקה ​​של oligonucleotides גדולים, כגון תבניות תורם, כולל תבניות תיקון מכוונות הומולוגיה, רצפי DNA טיפוליים ואלמנטים פוטנציאליים אחרים. תבניות התורמים ממוקמות רחוק יותר מפני השטח של AuNP מאשר מתחם הריבונוקלאופרוטאין המתואר (RNP) (איור 7 ד) ייצור מוצלח של 50 ננומטר AuNP הנושא את כל רכיבי העריכה הגנטית הנדרשים להכנסת רצף DNA טיפולי. תמונות מיקרוסקופ אלקטרונים שידור של AuNPs ו- Nanoformulations AuNP/CRISPR. ההתגלמות המתוארת כוללת AuNP הקשור ל- crRNA, Cpf1, ssDNA, קישורי תיאול, מפרידי פוליאתילן גליקול (PEG) ו- PEI2K. במיוחד, קישורי תיאול מחוברים ישירות לפני השטח של AuNP ו- crRNA. שימוש במקשר כזה מאפשר הצמדה של יותר crRNA אל פני השטח של AuNP, בין היתר מכיוון שהמרווחים מפחיתים את הדחייה בין המטען השלילי של מולקולות מבוססות RNA לבין המטען השלילי של פני AuNP. Cpf1 מקושר ל- crRNA ליצירת RNP. כדי לשפר את היעילות של HDR, יש לשחרר ssDNA מה- AuNP לפני חיתוך הגנום. בהתאם לכך, ssDNA נמצא רחוק יותר מפני השטח של ה- AuNP מאשר ה- RNP.

תאנה. 8. AuNPs טעונים במלואם הם חד-פיזוריים ומציגים פוטנציאל זטה טוב.

איורים. 9A-9D. גרפים ותמונות דיגיטליות המציגות את המאפיינים האופייניים של AuNPs מסונתזים וריכוזי טעינה אופטימליים. (איור 9 א) שיא תהודה פלסמונית (LSPR) מקומית של AuNPs מסונתזים. (איור 9 ב) פסגות LSPR של הננו -פורמולציות AuNP ו- AuNP/CRISPR. (איור 9 ג) אלקטרופורזה של ג'ל המציגה יחס טעינה אופטימלי של AuNP/ssDNA w/w. (איור 9 ד) ריכוז הטעינה של ננו -פורמולציות AuNP/CRISPR.

איורים. 10A-10C. ריכוזי טעינה אופטימליים. (איור 10A) AuNP/crRNA 50 ננומטר (יחס 6) AuNP/crRNA 15 ננומטר (יחס 1) ו- AuNP/crRNA/Cpf1/PEI/DNA 15 ננומטר (יחס 0.5) (איור 10 ב) AuNP אופטימלי 50 ננומטר/דנ"א יחס w/w (איור 100) AuNPs קטנים יותר משלשים את שטח הפנים הזמין עם אותן כמויות מגיב התחלתיות. על ידי הקטנת הגודל, שטח הפנים ויחס הצמידה של NPs להגדיל.

איורים. 11 א, 11 ב. (איור 11 א) HSPC תופסים AuNPs טעונים במלואם במבחנה. הדמיה של הזמן שחלף במיקרוסקופ קונפוקלי של דיסק מסתובב. תאים CD34+ מגויסים אנושיים → תרבות O/N → הוסף AuNPs (4 שעות) ΔAnalyze. (איור 11 ב) הדמיה מיקרוסקופית קונפוקלית המראה את קליטת רכיבי העריכה של CRISPR לתאים CD34+.

איורים.12A-12D. גרפים המראים את יעילות חיתוך הגן בתאי K562 ובתאי CD34+. (איורים 12A, 12B) תוצאות מעקב אחר אינדלים לפי פירוק (TIDE) המראים יעילות חיתוך באחוזים בתאים K562 ובתאים CD34+. (איור 12C) אחוז הכדאיות לאחר הלידה עם AuNPs ושיטת אלקטרופורציה. (איור 12 ד) מינון של רכיבי CRISPR.

תאנה. 13. עד 10% עריכת גנים ו- HDR נצפו במבחנה בתאים CD34+ הראשוניים שהתקבלו מתורם מבוגר בריא של G-CSF. תאי CD34+ הופשרו בשיטת הפשרה מהירה ותרבותו במשך לילה במדיום Dulbecco's IMCD של Iscove שהכיל 10% FBS ו- 1% עט/חזה. למחרת בבוקר, AuNPs נזרעו והורכבו כדלקמן: זרע הוסף crRNA עם מרווח PEG למניעת דחיות אלקטרוסטטיות הוסף חלבון Cpf1 ומאפשר RNPs ליצור מעיל עם PEI מסועף 2K ו- ssODN. בדוגמה זו, לא היו שינויים כימיים של crRNA מלבד תוספות תאול מסוף לקידום מליטה קוולנטית עם פני השטח AuNP לצורך התקשרות. SsODN שימשה כתבנית התיקון המכוונת להומולוגיה (HDT), כאן תוספת של 8 bp באמצעות אתר NotI המונח על ידי 40 nt של הומולוגיה (סימטרית) אל מוקד היעד של CCRS. AuNPs נוסחו נוספו לתאים והודגרו במשך 48 שעות עם ערבוב צלחות עדין. לאחר 48 שעות, תאים נקצרו, שטפו, ו- gDNA מבודד לצורך הגברה וניתוח PCR.

תאנה. 14. תוצאות assay TIDE המראות indels לאחר עריכה עם AuNP/CRISPR ננו -פורמולציות בתאי CD34+.

איורים. 15A-15D. (איור 15 א) 10 מיקרוגרם/מ"ל AuNP הוא ריכוז אופטימלי ל- HDR בתאי CD34+ בהם ניתן להשיג עריכת גנים מקסימלית ללא אובדן הכדאיות. אותו פרוטוקול שימש כמתואר ביחס לאיור. 13, פרט לכך שתאים CD34+ התקבלו בתחילה מתורם אנושי אחר. (איורים 15B, 15C) ניתוח כדאיות התא על-ידי assay Live-Dead (איור 15D) מייצג את הכדאיות של התא בתא בפורמט גרף עמודות.

תאנה. 16. מטרת המחקר המובילה לנתונים המוצגים באיור. 16 היה להשוות Cpf1 ו- Cas9 שנמסרו על ידי AuNP או electroporation, בהתאמה. שיטות זהות שימשו כמתואר ביחס לאיור. 13, פרט לכך שתאים CD34+ התקבלו בתחילה מתורם אנושי אחר. כל תנאי הניסוח היו זהים כך שהמשתנים היחידים הם Cpf1 לעומת Cas9 AuNP לעומת תבנית תיקון מכוונת הומולוגיה אלקטרופורציה (HDT ssODN) בהווה לעומת נעדר. תנאי אלקטרופורציה: קוביות אלקטרופורציה של 1 מ"מ 125 mV 5 אלפיות השנייה. עריכת ניתוח על ידי TIDE. מתואר רצף CCR5 שאינו מטרה של לוקוס CCR5 (מזהה מספר: 263)

איורים. 17A-17C. תנאי מדיה נטולי סרום ותומכי HSPC משתפרים (17א) עריכה, (17ב) HDR ו- (17ג) כדאיות התא.

איורים. 18 א, 18 ב. (איור 18 א) אין השפעה משמעותית על כושר HSPC במבחנה על ידי כל גרעין או שיטת משלוח כפי שנקבע על ידי מבחן ראשון ליצירת מושבה במתילצלולוז (H4434). תאים CD34+ נזרעו ב -200 תאים לכל צלחת 35 מ"מ עם זמן דגירה כולל של 14 ימים. (איור 18 ב) שיפור כושר ציפוי משני HSPC במבחנה עם AuNP/Cpf1. לוחות המושבה מ (איור 18 א) נקצרו ו -10% מההשעיה התא שהתקבלה נצפתה מחדש למבחן נוסף ליצירת מושבה ב- Methylcellulose (H4434). זוהי בדיקה פשוטה לקביעה האם תאים ליזום המושבה לטווח ארוך הושפעו מתנאי הניסוי. זמן הדגירה הכולל היה 14 יום. ההבדל המשמעותי היחיד שנצפה היה במספר המושבות לתאים שטופלו ב- AuNP+Cpf1/crRNA, שהציגו יותר תאים היוצרים מושבות ארוכות טווח. לא נצפו הבדלים משמעותיים בסוג המושבות שנוצרו בכל קבוצת ניסוי.

תאנה. 19. תאים CD34+ שטופלו ב- AuNP עוטפים in vivo. הערות ניסיוניות ומתודולוגיה. שיטות זהות שימשו כמתואר ביחס לאיור. 13, פרט לכך שתאים CD34+ התקבלו בתחילה מתורם אנושי אחר. לאחר 48 שעות, תאים נקצרו, נשטפו והוזרקו לעכברי NSG מבוגרים (8-12 שבועות) שהוקרנו באופן קבוע. עתודות תאים שימשו להערכת מבחני מושבת צלחות ולבידוד gDNA לצורך הגברה וניתוח PCR.

איורים. 20A-20C. ניתוח במבחנה של תאים שהושתלו בעכברי NSG. (איור 20 א) 10% HDR נצפתה על ידי TIDE ללא מחיצות משמעותיות במקום היעד בתאי CD34+ אנושיים בזמן ההשתלה. (איור 20B) עיכול ההגבלה של T7E1 ו- NotI נצפו רק בתאים שקיבלו ננו-פורמולציות AuNP טעונות במלואן. (איור 20C) באופן מעניין, יכולת גידול מושבה מוגברת לתורם זה צוינה רק כאשר תאים טופלו ב- AuNPs. לא נצפו הבדלים משמעותיים בסוגי המושבות שנוצרו בכל מצב.

איורים. 21 א -21 י. ניתוח in vivo של תאים שהושתלו בעכברי NSG. תאים hCD34+ שטופלו ב- AuNP סופגים טוב יותר מאשר תאים שטופלו בדומה. (איורים 21A, 21B) עכברים שהושתלו בתאים שטופלו ב- AuNP הציגו רמות גבוהות יותר של תאי CD45+ תאים אנושיים מאשר עכברים שהושתלו בתאים מדומים. (איורים 21C, 21D) לא נצפו הבדלים משמעותיים בתדירות תאי CD20+ אנושיים בין הקבוצות. (איורים 21E, 21F) לא נצפו הבדלים משמעותיים בתדירות תאי CD14+ אנושיים בין קבוצות. (איורים 21G, 21H) הבדלים משמעותיים בתדירות תאי CD3+ אנושיים נצפו בשבוע 14 ובעכברים שקיבלו AuNPs טעונים במלואם שהציגו את הכיוון האנושי הכולל הנמוך ביותר. תוצאה זו עשויה להיות חפץ של רמות תחריט נמוכות.

תאנה. 22. ניתוח מוקדם לאחר ההשתלה מצביע על השתלת תאים בעריכת גנים. דם היקפי נאסף לניתוח gDNA ב -6 שבועות לאחר ההשתלה (חץ באיור 21 I). בכל העכברים שטופלו ב- AuNPs טעונים במלואם, 7/10 הציגו עריכה ניתנת לתיקון הנעת בין 0.5-6% לפי TIDE. בעכבר אחד (5% עריכה כוללת), 1.7% HDR נצפתה על ידי ניתוח TIDE.

תאנה. 23. רצפים התומכים בחשיפה.

תיאור מפורט

לטיפול גנטי ספציפי לחולה יש פוטנציאל רב לטיפול במחלות גנטיות, זיהומיות וממאירות. לדוגמה, הוספת גנים בתיווך רטרו-וירוס לתאי גזע המטופויאטיים (HSC) ותאי גזע המטופויאטיים ותאי אבות (HSPC) הוכיחה תוצאות מרפאות למספר מחלות גנטיות במהלך 10 השנים האחרונות כולל פגמים חיסוניים תורשתיים (למשל, X-linked ו- adenosine deaminase חוסר חיסוני משולב חמור (SCID)), המוגלובינופתיה, תסמונת וויסקוט-אולדריך ולוקודיסטרופיה מטכומומטית. בנוסף, גישה טיפולית זו שיפרה גם את התוצאות לאבחנות פרוגנוזה גרועות כגון גליובלסטומה. השימוש ב- HSPC האוטולוגי המתוקן בגן, או "עצמי", מבטל את הסיכון לתגובות חיסוניות של מארח השתל, ושולל את הצורך בתרופות דיכוי חיסוני. עם זאת, יישום יעיל של טיפול גנטי ב- HSPC עומד בפני מספר אתגרים מרכזיים. המצב העדכני ביותר כולל הסרת תאים מהמטופל באמצעות אספיריית מח עצם או דם היקפי מגויס, מיון אוכלוסיה בתפזורת זו ל- HSPC אוטולוגי על ידי בחירה חיסונית של תאים המבטאים את סמן פני השטח CD34, ולאחר מכן טיפוח תאים אלה בנוכחות. של ציטוקינים ווקטור הרטרו -וירוס הטיפולי שצוין לפני הקציר. ניהול מחדש של תאים למטופל עשוי לדרוש התניה cytoreductive כדי לאפשר engraftment של התאים המתוקנים הגן. נכון לעכשיו, רק מרכזים עם מתקנים התואמים שיטות ייצור טובות (GMP) והתשתית לתמוך בהם מסוגלים לנהל מוצרי תאים שעברו שינוי גנים. בעוד שפותחה פלטפורמת ייצור פשוטה לאוטומציה של תהליך זה בטביעת רגל קטנה וניידת, כמויות מוגבלות מאוד של וקטורים טיפוליים זמינים המשיכו ליצור צוואר בקבוק משמעותי לשימוש נרחב בטכנולוגיה.

בנוסף לאתגר לייצר כמויות וקטוריות טיפוליות מספיקות, עדיין קיים סיכון ידוע לגנוטוקסיות הקשורות בשימוש בווקטורים רטרו -ויראליים להעברת גנים המעידים על התפתחות ממאירות עקב הכנסת מוטגניות לחולים המטופלים בטיפול גנטי ב- HSPC. תופעת לוואי שלילית זו נובעת מהאופי האקראי למחצה של העברת טרנסגנים בתיווך רטרו-ויראלי לגנום התא המארח. חוסר ויסות של גנים סמוכים על ידי רצף הטרנסגן שהוכנס היה הבסיס המולקולרי להתרחבות המשובטים והטרנספורמציה הממאירה שנצפו אצל חלק מהחולים בטיפול גנטי, אך אינטראקציות הדדיות בין הטרנסגן שהוכנס לבין ההקשר הגנומי שמסביב יכולות לגרום גם לנחתה ​​או השתקה של טרנסגנים, ולהפחית השפעות טיפוליות .

בחמש השנים האחרונות נתקלו בהתפוצצות בעריכת גנים כחלופה בטוחה יותר להעברת גנים בתיווך רטרו-וירוס, המתאפשרת על ידי פיתוח RNA מדריך מהונדס הקשור לגרעינים שמכוונים לרצפי DNA ספציפיים ויוצרים צפוי הפסקות גדילה כפולה של DNA (DSB) ב הרצף הממוקד. עד כה, המתחמים הניתנים לתכנות היו היעילים ביותר במתן טיפולים מבטיחים כאשר יש צורך בהסרה או השתקה של גן בעייתי (כלומר יצירת מוטציה של אובדן תפקוד). הסיבה לכך היא ש- DSB מתוקנים בדרך כלל על ידי הצטרפות קצה לא הומולוגית מועדת לשגיאה (NHEJ) וכתוצאה מכך הוספות ומחיקות oligonucleotide באתר DSB.

לצורך הוספה או תיקון גנים של מוטציה ספציפית, נדרש תיקון פחות מכוון הומולוגי (HDR) של ה- DSB. במצב זה, יש להעביר במשותף מטען מורכב יותר הכולל את מדריך ה- RNA והגרעין המתוכנן, ותבנית תיקון מכוונת הומולוגיה עם הומולוגיה לאזור DSB היעד. הוכחת תפיסה לגישה זו הודגמה ב- HSPC אך גם נדרשה אלקטרופורציה טנדמית של רכיבי עריכת הגנום ואחריה התמרה עם וקטורים ויראליים שאינם משתלבים, במיוחד וקטורים ויראליים (rAAV) רקומביננטיים המסופקים על ידי אספקת תבניות DNA, או בו זמנית אלקטרופורציה של ריכוזים מוגדרים של רכיבי נוקלאז מהונדסים עם תבנית אוליגונוקלאוטיד חד-גדילית בריכוז תאים שצוין. יתר על כן, כל תבנית תיקון המכוונת ל- RNA, נוקלאז ותכשיר הומולוגיה הייתה חייבת להיות מתוכננת באופן ייחודי לכל יעד גנטי שצוין, ודורשת הערכה נפרדת של מסירה, פעילות וספציפיות בשורות תאים וב- HSPC.

לפיכך, למרות שהיו הרבה פריצות דרך מרגשות ביכולת לבצע טיפולים גנטיים באתרים ספציפיים בתוך הגנום, המחסור המתמשך בכלי אספקה ​​בטוח וחזק הפריע לתרגום הקליני של מערכות עריכת גנים, בפרט, עם HSPC.

הרעיון של נמל בטוח גנומי (GSH) לשינוי גנטי הוצג לראשונה בשנת 2011 על ידי Papapetrou ועמיתיו (Nature Biotechnology. 2011 29 (1): 73-8). הקריטריונים העיקריים המוצעים להגדרת אתר GSH הם (1) היכולת להכיל חומר גנטי חדש עם, (2) פונקציה ניתנת לחיזוי ו (3) ללא שינויים שעלולים להזיק בפעילות הגנומית של תאי המארח. היתרון בזיהוי מוקד כזה יפשט מאוד את מאמצי הפיתוח לגישות תוספת גנים ממוקדות. כמה לוקוסים הוערכו בגנום האנושי, אך עד כה לא זוהו אתרי GSH מאומתים בתום לב העונים לקריטריונים לעיל. Papapetrou et al., Mol. תר. 201624 (4): 678-84.

הגילוי הנוכחי מספק התקדמות משמעותית ביכולת לבצע טיפולים גנטיים במגוון מחלות גנטיות, זיהומיות וממאירות על ידי מתן זיהוי של נמלי בטוח גנומיים (GSH) בתוך תאי גזע המטופויאטיים (HSC) ותאי גזע המטופויטיים ותאי אבות (HSPC). חלק מ- GSH המזוהה מתאימים בנוסף למקומות הנמל הבטוחים האוניברסליים של HSC, כפי שמתואר בפירוט נוסף כאן.

הגילוי הנוכחי מספק גם חלקיקים שנועדו במיוחד לספק את כל הרכיבים הנדרשים לעריכה גנטית, למשל, באתרי GSH. חלקיקי הננו יכולים לשמש לטיפולים בהם יש צורך במוטציה של אובדן תפקוד, אך חשוב מכך, יכולה לספק גם את כל המרכיבים הדרושים להוספת גנים או לתיקון של מוטציה ספציפית. הגישות המתוארות הן בטוחות (כלומר, ללא רעילות מחוץ למטרה), מהימנות (כרומטין תאי GSH ממוקד נגיש ומתאים לתוספות טיפוליות), ניתנות להרחבה, קלות לייצור, סינתטיות, plug-and-play (כלומר, אותה פלטפורמה בסיסית יכול לשמש לאספקת חומצות גרעין טיפוליות שונות), ותואם למתן קל in vivo (באמצעות, למשל, מזרק).

התגלמויות מיוחדות כוללות חלקיק ננו עם רכיבים המספקים מוטציה ממוקדת של אובדן תפקוד. התגלמויות אלה כוללות אלמנט מיקוד (למשל, מדריך RNA) ורכיב חיתוך (למשל נוקלאז) הקשור לפני השטח של החלקיק. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד ו/או רכיב החיתוך מצומדים אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול ורכיב החיתוך מקושר לאלמנט המיקוד ליצירת קומפלקס ריבונוקלאופרוטאין (RNP). רכיב המיקוד מכוון את רכיב החיתוך לאתר ספציפי לחיתוך ולתיקון NHEJ.

התגלמויות מיוחדות כוללות חלקיק ננו עם רכיבים המספקים מוטציה ממוקדת של רווח תפקוד (למשל, הוספת גן או תיקון). התגלמויות אלה כוללות רכיב מיקוד, אלמנט חיתוך, תבנית תיקון מכוונת הומולוגיה ורצף DNA טיפולי הקשור לפני השטח של החלקיק. רכיב המיקוד מכוון את רכיב החיתוך לאתר ספציפי לחיתוך, תבנית התיקון המכוונת להומולוגיה מספקת תיקון HDR, שבו לאחר תיקון HDR הוכנס רצף ה- DNA הטיפולי לאתר המטרה. יחד, ניתן להתייחס לתבניות תיקון המכוונות להומולוגיה ולרצפי DNA טיפוליים כתבניות תורמות. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד ו/או רכיב החיתוך מצומדים אל פני השטח של החלקיקים באמצעות מקשר תיול. בהתגלמויות מסוימות, רכיב המיקוד מצומד אל פני השטח של החלקיקים באמצעות מקשר תיול ורכיב החיתוך מקושר לאלמנט המיקוד ליצירת קומפלקס ריבונוקלאופרוטאין (RNP). בהתגלמויות אלה, מתחם ה- RNP קרוב יותר לפני השטח של חלקיק הננו מאשר חומר תבנית התורם. תצורה זו מועילה כאשר, למשל, רכיב המיקוד ו/או רכיב החיתוך הם ממוצא חיידקי. הסיבה לכך היא שאנשים רבים שעשויים לקבל חלקיקים המתוארים במסמך זה עשויים להיות בעלי חסינות קיימת מראש כנגד רכיבים הנגזרים מחיידקים, כגון רכיבים העריכים של חיידקים הנגזרים. הכללת רכיבי עריכת גנים שמקורם בחיידקים בשכבה פנימית של חלקיק הנוסח במלואו מאפשרת למרכיבים שאינם נגזרים מחיידקים (למשל תבניות תורם) להגן על רכיבים הנגזרים מחיידקים (למשל רכיבי מיקוד ו/או חיתוך) מפני מערכת החיסון של המטופל. מערכת. זה מגן על הרכיבים הנגזרים מחיידקים מפני התקפה וגם מונע או מפחית תגובות דלקתיות לא רצויות נגד חלקיקי התרופה לאחר הניהול. בנוסף, הדבר עשוי לאפשר ניהול חוזר של החלקיקים in vivo ללא הפעלה על ידי התגובה החיסונית המארחת.

התגלמויות מיוחדות משתמשות בעריכת גנים של CRISPR. בהתגלמויות מסוימות, עריכת גנים של CRISPR יכולה להתרחש עם RNA מדריך CRISPR (crRNA) ו/או נוקלאז CRISPR (למשל, Cpf1 או Cas9).

התגלמויות מיוחדות מאמצות תכונות המגבירות את היעילות ו/או הדיוק של HDR. לדוגמה, ל- Cpf1 יש crRNA יחיד קצר וחותך את DNA המטרה בצורה מכווצת עם 5 ′ 2-4 נוקלאוטיד (nt) תלויים הנקראים קצוות דביקים. קצוות דביקים נוחים ל- HDR, קים ואחרים. (2016) נט ביוטכנול. 34 (8): 863-8. יתר על כן, יש לשחרר תבניות תורמים מהחלקיקים לפני שהגנום יחתך על ידי ה- RNP כדי לקדם HDR. בהתאם לכך, התגלמויות מסוימות המתגלות כאן תבניות התורמים נמצאות רחוק יותר מפני השטח של החלקיקים מאשר רכיבי מיקוד ורכיבי חיתוך. הגילוי הנוכחי גם מצא במפתיע כי אספקה ​​של רכיבי עריכת גנים על חלקיקי זהב מגבירה את היעילות ו/או הדיוק של HDR. בהתאם לכך, התגלמויות מסוימות מספקות רכיבי עריכת גנים תוך ניצול חלקיקי זהב.

בהתגלמויות מסוימות, ניתן להשתמש במולקולות מיקוד כדי למקד את חלקיק הננו לתא ספציפי כך שניתן לשלוט בפעילות של מערכת עריכת הגנים באופן מרחבי או זמני. לדוגמה, הפעילות והיעד של מערכת עריכת הגנים עשויה להיות נשלטת על ידי מולקולת מיקוד הקושרת סמן משטח תא, כגון CD34 או CD90.

בהתגלמויות בהן משתמשים במרכיבי עריכת גנים ממוצא חיידקי, הגילוי הנוכחי לוקח בחשבון גם כי אנשים רבים שעשויים לקבל חלקיקים המתוארים במסמך זה עשויים להיות בעלי חסינות קיימת מראש כנגד רכיבים כאלה. כדי לטפל בחסינות פוטנציאלית קיימת זו, רכיבי עריכת גנים ממוצא חיידקי עשויים להיות מצומדים ישירות לפני השטח של חלקיקים ואחריהם הוספת תבניות תורם. בתצורה זו, תבניות התורם יכולות להגן על רכיבי עריכת הגנים מפני התקפה חיסונית ולהימנע או להפחית תגובות דלקתיות לא רצויות נגד חלקיקים לאחר הניהול.

ההיבטים הבאים של הגילוי מתוארים כעת עם פירוט ואפשרויות נוספות לתמיכה בתורת הגילוי כדלקמן: (I) Harbour Safe Harbors (GSH) ו- Universal HSC Safe Harbour Loci ב- HSC ו- HSPC (II) מערכות עריכת גנים ורכיבים למקד ולשנות אתרי GSH (Ill) חלקיקי ננו (IV) הצמדה של רכיבים פעילים לננו -חלקיקים (V) יעילות עריכת גנים (VI) תרכובות ננו -חלקיקים וניסוחי תאים (VII) שיטות שימוש ומופת (VIII) רמות הפניה הנגזרות ערכות אוכלוסיית השליטה (IX) ו- (X) דוגמאות למופת.

(א) נמלי כספות גנומיים (GSH) ו- Universal HSC Safe Harbour Loci ב- HSC ו- HSPC אנושי. כפי שצוין, חסרון אחד עם טיפולים גנטיים קיימים הוא שלא ניתן לשלוט בצורה מספקת באתר ההחדרה של וקטורים רטרו -ויראליים. מערכות עריכת גנים מאפשרות שליטה על אתרי היעד של טיפולים גנטיים, אולם לפני הגילוי הנוכחי לא זוהו אתרי GSH מאומתים בתום לב בגנום האנושי (Papapetrou et al., Mol. Ther. 2016 24 (4): 678 -84), כפי שהציע הרעיון על ידי Papapetrou ועמיתיו בביוטכנולוגיה של הטבע.2011 29 (1): 73-8) (כלומר, (1) היכולת להכיל חומר גנטי חדש עם, (2) פונקציה ניתנת לחיזוי, ו (3) ללא שינויים שעלולים להזיק בפעילות הגנומית של תאי המארח).

אחד האתגרים של שילוב החומר הגנטי בתאים הוא לקבוע היכן בתוך הכרומוזומים ניתן לשלב את החומר הגנטי בבטחה. הגילוי הנוכחי פותר בעיה זו על ידי מתן אזורים הנגישים לכרומטין בתא CD34 + ותת CD34 (CD45RA-ו- CD90 +) בתאי פרימטים אנושיים ולא אנושיים (ראה, למשל, WO 2017/218948 ו- Radtke et al., Sci . Transl. Med. 2017 9 (414) בעלות יעילות עריכה גבוהה וסבירות נמוכה לשיבוש הפוטנציאל הסלולרי. בהתגלמויות מסוימות האתרים מתאימים כמקומות אוניברסליים של HSC בטוח לנמל. בהתגלמויות מסוימות, כדי לעמוד בקריטריונים של כספת HSC אוניברסלית. לוקוסים בנמל, אתרי הכרומטין חייבים להיות רחוקים מ- gb150 kb מאונקוגן ידוע, & gt30 kb מאתר התחלת תעתוק ידוע ואין להם חפיפה עם קידוד mRNA. בהתגלמויות מסוימות, כדי לעמוד בקריטריונים של לוקוסים אוניברסליים של HSC בטוח בנמל, כרומטין חייב להיות רחוק & kt200 kb מאונקוגן ידוע, & gt40 kb מאתר התחלת תעתוק ידוע ואין להם חפיפה עם קידוד mRNA. בהתגלמויות מסוימות, כדי לעמוד בקריטריונים של לוקוסים אוניברסליים של HSC safe Harbour, אתרי כרומטין. חייב להיות רחוק & gt300 kb מאונקוגן ידוע, & gt50 kb רחוק מאתר התחלת שעתוק ידוע ואין להם חפיפה עם קידוד mRNA. בהתגלמויות מסוימות, לוקוסים אוניברסליים של HSC בטוח לנמל עומדים בקריטריונים הקודמים (& gt150 kb, & gt200 kb או & gt300 kb הרחק מאתר התחלת שעתוק ידוע ואין להם חפיפה עם קידוד mRNA & gt40 kb, או & gt50 kb הרחק מאתר התחלת תמלול ידוע ללא חפיפה עם קידוד mRNA) ובנוסף הוא 100% הומולוגיים בין הפרימאט הלא אנושי לבין הגנום האנושי כדי לאפשר תרגום קליני מהיר של אוכלוסיות ערוכות גנים אלה. בהתגלמויות מסוימות, לוקוסים אוניברסליים של HSC בטוח לנמל עונים על הקריטריונים הקודמים ומדגים יחס של 1: 1 של כיוון קדימה: כיוונים הפוכים של שילוב LV עוד מוכיחים שהמקום אינו משפיע על החומר הגנטי שמסביב.

התהליך לזיהוי GSH בתוך הגנום האנושי התחיל בהערכת התוצאה הביולוגית של חקיקה ארוכת טווח של תאים CD34 + אוטולוגיים הנותנים באוטולוגים ב- LIV (LV) במקק המזויף (מ 'נמסטרינה), מודל פרימטים לא אנושי מבוסס המשמש להערכות פרה-קליניות של טיפול גנטי ב- HSC ו- HSPC. ניתוח תפוקה גבוהה של אתרים של שילוב LV שימש לזיהוי לוקי GSH המועמד. LVs יכולים להעביר תאים שאינם מתחלקים, ולהשתלב באופן מועדף ביחידות שעתוק פעילות בגנום התא המארח. מוקד האינטגרציה נקבע בזמן העברת הגן והוא יורש על ידי כל תא בת. 150,000 אתרי שילוב LV שזוהו בתאי דם שנאספו משנים עשר בעלי חיים במהלך תקופה של 2-7 שנים לאחר ההשתלה חולקו ל -1,077 חלונות גנומיים בגודל 25 קילו-בתים המציגים תדרי אינטגרציה מועשרים באופן משמעותי ביחס לשאר הגנום (טבלה 1).

מוקד נגיש שפיר צפוי להציג יחס של 1: 1 של כיוונים קדימה: הפוכה של שילוב LV. לפיכך, הרשימה חולקה עוד יותר ל -664 חלונות גנומיים עם כיוון לאחור של אירועי אינטגרציה. מתוכם, 662 חלונות הכילו אירועי אינטגרציה שיוצגו על ידי 3 או יותר משכפלים ביולוגיים (≥3 מתוך 12 קופים שניתחו).

החלונות סוננו על בסיס הומולוגיה לגנום האנושי (hg38) ובסך הכל זוהו 171 חלונות עם 90% הומולוגיה. כדי להגביר את הבטיחות, הוחלבו חלונות אלה כנגד מאגר הנתונים של הגן COSMIC סרטן. חלונות נשמרו רק אם הם היו במרחק של & gt300 קילו־בייט מאונקוגן ידוע. מסנן זה גרם ל -122 חלונות. כל חלונות שנמצאים בטווח של 50 קילוגרם של אתר התחלת שעתוק הוסרו, מה שהביא ל -24 חלונות, כולם ממוקמים באופן עדיף ברצפים אינטרוניים. שני אזורים גנומיים היו מועשרים ביותר ב -24 חלונות אלה: כרומוזום 11q13.2 וכרומוזום 16p12.1.

שני המיקומים העשירים בגן מתבטאים באופן מכונן בתאי דם, מה שמעיד על כך ש (1) ביטוי של טרנסגנים לא צפוי להפעיל גנים סמוכים שצריכים להיות מושתקים בתאי דם, ו (2) רצפי טרנסגנים מוכנסים לא ייחלשו או יושתקו. במהלך הבידול ההמטופויטי [אוניברסיטת קליפורניה בסנטה קרוז (UCSC) דפדפן הגנום ו- ENCODE]. שני לוקוסים אלה נותחו עוד יותר על פי הקריטריונים הבאים: תת-תחומי מטרה זוהו כרצפים ייחודיים עם (1) 100% הומולוגיה בין הפרימטים (RheMac3) לבין הגנום האנושי (hg38), ו (2) ללא חפיפה עם קידוד mRNA. הקריטריונים האחרונים לא כללו את הכרומוזום 16p12.1 כמוקד GSH מכיוון שהוא חופף למספר mRNAs.

האתרים הבאים שזוהו על ידי הניתוח הם 100% הומולוגיים בין הגנום האנושי לגנום הרזוס.

אזורים אלה של כרומוזום 11q13.2 מייצגים אתרים אוניברסליים של HSC בטוח בנמל HSC. האתרים הבאים הראו גם התירצות לשינוי גנטי ללא השלכות ביולוגיות שליליות, אפילו בלחץ סלקטיבי in vivo ומייצגים אתרי GSH: chr11: 67523429-67533593 chr11: 67681215-67741765 chr11: 67805337-67845629 chr11: 67895738-67941098 chr5: 6642598 chr8: 28980753-29006178 chr16: 28151114-28175716 chr1: 39189118-39214131 chr17: 2149700-2174592 chr14: 35658075-35685512 chr18: 9198556-9223041chr5: 140463887-140488886681184 : 8600474-8624530 chr12: 50609483-50635221 chr16: 28175717-28199134 chr17: 63329602-63353111 chr1: 107643312-107672400 chr17: 65870579-65895504 chr2: 224533608-2245592 בהתגלמויות מסוימות, chr11: 67681215-67741765, chr11: 67805337-67845629 ו/או chr11: 67895738-67941098 ממוקדות לשינוי גנטי.

לוקסי אוניברסלי חלון בטוח של HSC ב- chr11 שרלוונטיים במיוחד לעריכת גנים (כמתואר בפירוט רב יותר ביחס לעריכת גנים להלן) כוללים: 67935219-67935243 67911598-67911622 67939901-67939925 67927758-67927782 67917930-67917954 67918042-67918066 67931497 67936715-67936739 67921126-7921150 67914940-67914964 67928284-67928308 67936068-67936092 67922372-67922396 67811255-67811279 67840351-67840375 67821576-67821600 67827279-67827303 67822563-7822587 67823914-67823938 67818875-67818899 67811907-67811931 67811630-67811654 7836644-67836668 67806757 -67806781 67823923-67823947 67841379-67841403 67808086-7808110 67823903-67823927 67686904-67686928 67692610-67692634 67692462-67692486 67692618-67692642 67705405-67705429 67686651-67686675 67686788-67686812 67684033-7684057 67681565-67681589 67704652-67704676 67689328-67689352 67688546-67688570 67693464-67693488 67682343-67682367 67689948-67689972 67684785-67684809 67684738-67684762 67684260-67684284 67684173- 67684197 67687315-67687339 67682671-67682695 67691534-67691558 67690743-67690767 67693746-67693770 67690174-67690198 67692535-67692559 67687605-67687629 67694747-67694771 67681441-67681465 67691508-67691532 67692057-67692081 67692573-67692597 67690331-67690355 67697247-67697271 67695745-67695769 67695241 -67695265 67691931-67691955 67691017-67691041 67694689-67694713 67721934-67721958 67696164-67696188 67736715-67736739 67681498-67681522 67690926-67690950 67694271-67694295 67682715-67682739 67694107-67694131 67692129-67692153 67721153-67721177 67726733-67726757 67694551-67694575 67684767-67684791 67686717-67686741 67692858-67692882 67694890-67694914 7706343-67706367 67681596-67681620 67684153-67684177 67690025-67690049 67691225-67691249 67692361-67692385 67692291-67692315 67684752-67684776 67690917-67690941 67695354-67695378 67685964-67685988 67690852-67690876 67698221-67698245 67713445- 67713469 67693965-67693989 67689830-67689854 67690151-67690175 67718079-67718103 67692663-67692687 67 684143-67684167 67702560-67702584 67689807-67689831 67734305-67734329 67691410-67691434 67691162-67691186 67702695-67702719 67689612-67689636 67697284-67697308 67691567-67691591 67685635-67685659 67689900-67689924 67696035-67696059 67687462-67687486 67689863-67689887 67690831-67690855 67696956- 67696980 67703966-67703990 67692382-67692406 67693741-67693765 67682707-67682731 67689891-67689915 67695833-67695857 67689800-67689824 67693566-67693590 67681587-67681611 67702113-67702137 67701288-67701312 67689761-67689785 67723825-67723849 67686892-67686916 67698097-67698121 67687614-67687638 67703251 -67703275 67690109-67690133 67719750-67719774 67691762-67691786 67691654-67691678 67695445-67695469 67694579-67694603 67693002-67693026 67731932-67731956 67689608-67689632 67691726-67691750 67704995-67705019 67694095-67694119 67688285-67688309 67692918-67692942 67735442-67735466 67694119-67694143 67694791-67694815 67695843-67695867 67695032-67695056 67703734-67703758 67690809-67690833 67697085-676 97109 67690629-67690653 67701642-67701666 67693639-67693663 67703876-67703900 67690054-67690078 67695062-67695086 67689878-67689902 67696347-67696371 67694806-67694830 67690245-67690269 67695377-67695401 67694295-67694319 67705602-67705626 67693729-67693753 67694696-67694720 67694318-67694342 67697768 -67697792 67694989-67695013 67687551-67687575 67694309-67694333 67693926-67693950 67693602-67693626 67693896-67693920 67718020-67718044 67700346-67700370 67696171-67696195 67729142-67729166 67684112-67684136 67693375-67693399 67691807-67691831 67700198-67700222 67697504-67697528 67701370-67701394 67703871-67703895 67683323-67683347 ו- 67690737-67690761. אתרים אלה מייצגים מספר מזהה SEQ. 1-194 כפי שניתן בטבלה 3 להלן.

בעוד לוקוסים GSH המתוארים כאן מתאימים באופן אידיאלי למניפולציה גנטית ב- HSC כולל קבוצת משנה לתאי CD34 +, CD34 + CD45RA - CD90 + HSC), סוגי תאי דם מתאימים אחרים כוללים תאי אב hematopoietic (HPC), גזע hematopoietic ותא אב (HSPCs) , תאי T, תאי הרוצח הטבעי (NK), תאי B, מקרופאגים, מונוציטים, תאי גזע מזנכימליים (MSC), תאי דם לבנים (WBC), תא חד -גרעיני (MNC), תאי אנדותל (EC), תאי סטרומה ומח עצם פיברובלסטים. ניתן לכנות ביחד סוגי תאים אלה "תאי דם".

(II) מערכות לעריכת גנים ורכיבים למיקוד ושינוי של אתרי GSH. זיהוי ה- GSH המתואר לעיל והגדרות קפדניות יותר של אוניברסלי HSC בטוח לנמל מאפשרים מיקוד באמצעות מערכות עריכת גנים, מה שמגדיל מאוד את בטיחות הטיפולים הגנטיים. בתוך תורת הגילוי הנוכחי, ניתן להשתמש בכל מערכת לעריכת גנים המסוגלת למקד ולשנות רצפים מדויקים. מערכות אלה כוללות בדרך כלל רכיב מיקוד למיקוד מדויק ורכיב חיתוך לחיתוך האתר הגנטי הממוקד. מדריך RNA הוא דוגמה אחת לאלמנט מיקוד בעוד שגרעינים שונים מספקים דוגמאות לאלמנטים חיתוך. רכיבי מיקוד ואלמנטים חיתוכים יכולים להיות מולקולות נפרדות או מקושרות, למשל, על ידי חלקיק ננו. לחלופין, ניתן לחבר אלמנט מיקוד ואלמנט חיתוך יחד למולקולה דו -תכליתית אחת. כאשר הכוונה להכנסת רצף חומצות גרעין טיפולי, המערכות כוללות גם תבנית תיקון מכוונת הומולוגיה (שיכולה לכלול זרועות הומולוגיה) הקשורה לרצף חומצת הגרעין הטיפולי. אולם כפי שיפורט בהמשך, מערכות עריכת גנים שונות יכולות לאמץ רכיבים ותצורות שונות תוך שמירה על היכולת למקד, לחתוך ולשנות אתרים גנומיים נבחרים.

התגלמויות מיוחדות משתמשות בגרעיני אצבע אבץ (ZFNs) כסוכני עריכת גנים. ZFNs הם סוג של גרעינים ספציפיים לאתר שנועדו לקשור ולדבק DNA במיקומים ספציפיים. ZFN משמשים להכנסת הפסקות גדילה כפולה (DSB) באתר ספציפי ברצף DNA המאפשר ל- ZFN למקד רצפים ייחודיים בתוך הגנום במגוון תאים שונים. יתר על כן, לאחר שבירה כפולה, תיקון מונחה הומולוגיה (HDR) או חיבור קצה לא הומולוגי (NHEJ) מתקיים לתיקון ה- DSB, ובכך מאפשר עריכת גנום.

ZFN מסונתזים על ידי מיזוג תחום מחייב DNA של אצבע אבץ לתחום מחשוף DNA. התחום המחייב DNA כולל שלושה עד שישה חלבוני אצבע אבץ שהם גורמי שעתוק. תחום מחשוף הדנ"א כולל את התחום הקטליטי של, למשל, אנדו -נוקלאז FokI. תחום ה- FokI מתפקד כדימר הדורש שני מבנים עם תחומים מחייבים DNA ייחודי לאתרים ברצף היעד. תחום המחשוף FokI מתחלק בתוך רצף מרווח של חמישה או שישה זוגות בסיס שמפרידים בין שני האתרים הפוכים למחצה.

למידע נוסף בנוגע ל- ZFN, ראו קים ואחרים. ההליכים של האקדמיה הלאומית למדעים של ארצות הברית של אמריקה 93, 1156-1160 (1996) Wolfe, et al. סקירה שנתית של הביופיזיקה והמבנה הביו-מולקולרי 29, 183-212 (2000) Bibikova, et al. מדע 300, 764 (2003) ביביקובה ואחרים. גנטיקה 161, 1169-1175 (2002) מילר, ואחרים. כתב העת EMBO 4, 1609-1614 (1985) ומילר ואחרים. טבע ביוטכנולוגיה 25, 778-785 (2007)].

התגלמויות מיוחדות יכולות להשתמש במפעיל שעתוק כמו גרעיני אפקטור (TALEN) כסוכני עריכת גנים. TALEN מתייחסים לחלבוני היתוך, כולל חלבון מחייב דמוי מעתיק (TALE) DNA ותחום מחשוף DNA. TALEN משמשים לעריכת גנים וגנום על ידי גרימת DSBs ב- DNA, המעוררים מנגנוני תיקון בתאים. באופן כללי, שני TALEN חייבים לאגד ולאגוד כל צד של אתר ה- DNA היעד כדי שתחום מחשוף ה- DNA יעמום ויגרום ל- DSB. ה- DSB מתוקן בתא על ידי NHEJ או HDR אם קיים שבר DNA תורם אקסוגני של תורם.

כפי שצוין, TALEN תוכננו בכדי לקשור רצף יעד של, למשל, גנום אנדוגני, ולחתוך DNA במיקום של רצף המטרה. TALEs של TALEN הם חלבונים מחייבי DNA המופרשים על ידי קסנתומונס בַּקטֶרִיָה. התחום המחייב את ה- DNA של TALE כולל חזרה על חומצות אמינו 33 או 34 שמורות מאוד, עם שאריות שונות בעמדות ה -12 וה -13 של כל חזרה. שתי עמדות אלו, המכונות Diresidue Variable Repeat (RVD), מציגות מתאם חזק עם זיהוי נוקלאוטיד ספציפי. בהתאם לכך, ניתן לשפר את ספציפיות המיקוד על ידי שינוי חומצות האמינו ב- RVD ושילוב חומצות אמינו RVD לא שגרתיות.

דוגמאות לתחומי מחשוף DNA שניתן להשתמש בהם באיחודי TALEN הם אנדונוקליזות מסוג FokI מסוג wild. למידע נוסף אודות TALEN, ראה Boch et al. Science 326, 1509-1512 (2009) Moscou, & Bogdanove, Science 326, 1501 (2009) Christian, et al. גנטיקה 186, 757-761 (2010) ומילר ואחרים. טבע ביוטכנולוגיה 29, 143-148 (2011).

התגלמויות מיוחדות משתמשות ב- MegaTAL כסוכני עריכת גנים. ל- MegaTAL יש מבנה נוקלאז נדיר בבידוד של שרשרת אחת שבה TALE מתמזג עם תחום המחשוף של ה- DNA של מגנו-נוקליז. Meganucleases, הידועים גם בשם homing endonucleases, הם שרשראות פפטיד בודדות שיש להן זיהוי DNA ותפקוד נוקלאז באותו תחום. בניגוד ל- TALEN, ה- megaTAL דורש רק אספקה ​​של שרשרת פפטיד אחת לפעילות תפקודית.

בהתגלמויות מסוימות, ניתן למקד את GSH באמצעות מערכות עריכת גנים של CRISPR. מערכת הגרעין CRISPR היא מערכת חיסון פרוקריוטית המעניקה עמידות בפני יסודות גנטיים זרים כגון פלסמידים ופאגים ומספקת צורה של חסינות נרכשת. CRISPR הם לוקי DNA המכילים חזרות קצרות של רצפי בסיס. בהקשר של מערכת חיסון פרוקריוטית, כל חזרה מלווה בקטעים קצרים של DNA מרווח השייך לאלמנטים גנטיים זרים שהפרוקריוט נחשף אליהם. ניתן לתמלל מערך CRISPR זה של חזרות ביניהן רווחי מרווחים ל- RNA. ניתן לעבד את ה- RNA לצורה בוגרת ולהתרועע עם נוקלאז קז (קשור ל- CRISPR). מערכת CRISPR-Cas הכוללת RNA בעל רצף שיכול להיכלל עם היסודות הגנטיים הזרים ו- Nuclease Cas יכולה לאחר מכן לזהות ולחתוך את האלמנטים הגנטיים האקסוגניים האלה בגנום.

מערכת CRISPR-Cas אינה דורשת יצירת חלבונים מותאמים אישית כדי למקד לרצפים ספציפיים, אלא ניתן לתכנת אנזים Cas יחיד על ידי מולקולת RNA קצרה (crRNA) קצרה לזיהוי יעד DNA ספציפי. מערכות CRISPR-Cas של חסינות מסתגלת חיידקית וארכאית מציגות מגוון קיצוני של הרכב החלבונים וארכיטקטורת לוקוסים גנומית. למקומות מערכת CRISPR-Cas יש יותר מ -50 משפחות גנים ואין גנים אוניברסליים למהדרין, דבר המצביע על התפתחות מהירה ומגוון קיצוני של ארכיטקטורת לוקוסים. עד כה, מאמצת גישה מרובת שיטות, קיימת זיהוי מקיף של הגן cas של 395 פרופילים עבור 93 חלבוני Cas. הסיווג כולל פרופילי גנים חתימים בתוספת חתימות של ארכיטקטורת לוקוס. מוצע סיווג חדש של מערכות CRISPR-Cas בהן מערכות אלה מתחלקות באופן כללי לשתי סוגים, מחלקה 1 עם מתחמי אפקטור מרובי-יחידות ומחלקה 2 עם מודולי אפקטור יחידה-יחידה המופגשים על ידי חלבון Cas9. הוכח עריכת גנים יעילה בתאי CD34+ אנושיים באמצעות אלקטרופורציה של CRISPR/Cas9 mRNA ואוליגודוקסיריבונוקלאוטיד חד-גדילי (ssODN) כתבנית תורם ל- HDR. דה ראבין ואח '. Sci Transl Med. 2017 9 (372): eaah3480. חלבונים אפקטוריים חדשים הקשורים למערכות CRISPR-Cas מסוג 2 יכולים להיות מפותחים ככלי הנדסי גנום רב עוצמה ולחיזוי חלבונים אפקטוריים משוערים וההנדסה והאופטימיזציה שלהם חשובה. בנוסף למערכות CRISPR-Cas Class 1 ו- Class 2, לאחרונה זוהתה מחלקה משוערת מסוג 2, סוג V CRISPR-Cas שמוצג ב- Cpf1, Zetsche et al. (2015) תא 163 (3): 759-771.

מידע נוסף אודות מערכות CRISPR-Cas ומרכיביהן מתואר ב, Pat. U.S. מס '8,697,359, 8,771,945, 8,795,965, 8,865,406, 8,871,445, 8,889,356, 8,889,418, 8,895,308, 8,906,616, 8,932,814, 8,945,839, 8,993,233 ו 8,999,641 ו- W2020, W2020/W2020 093655, WO2014/093661, WO2014/093694, WO2014/093701, WO2014/093709, WO2014/093712, WO2014/093718, WO2014/145599, WO2014/204723, WO2014/204724, WO2014/204725, 2047/204725, WO2014/204728, WO2014/204729, WO2015/065964, WO2015/089351, WO2015/089354, WO2015/089364, WO2015/089419, WO2015/089427, WO2015/089462, WO2015/089465, W2020/089465 WO2017/106657, WO2017/127807 ויישומים הקשורים לכך.

הגרעין Cpf1 יכול במיוחד לספק גמישות נוספת בבחירת אתר היעד באמצעות רצף זיהוי קצר של שלושה זוגות בסיס (TTN), המכונה המוטיב הסמוך ל- protospacer או PAM.אתר החיתוך של Cpf1 מרוחק לפחות 18 bp מרצף ה- PAM, ולכן האנזים יכול לחתוך שוב ושוב נקודה מסוימת לאחר היווצרות אינדל (הכנסה ומחיקה), ולהגדיל את היעילות של HDR. יתר על כן, DSBs מדורגים עם קצוות דביקים מאפשרים הכנסת תבנית תורם ספציפית לכיוון, וזה יתרון בתאים שאינם מתחלקים.

בשלושה חלונות של אתרי GSH מזוהים בכרומוזום 11q13.2 נמצאו אתרי מטרה מסוג Cpf1 שהכילו את רצף ה- PAM המועדף ביותר (TTTA) ו- 21 bp DNA סמוך שהיה ייחודי לחלוטין לגנום האנושי. סך של 194 אתרי חיתוך מטרה זוהו לפי קריטריונים אלה ומפורטים בטבלה 3. כל אחד מהרצפים שזוהו מספק אתר מועיל למיקוד ספציפי לטיפול גנטי. רצפי חומצת הגרעין המתוארים מוצגים באמצעות קיצורי אותיות סטנדרטיים לבסיסי נוקלאוטיד, כהגדרתם ב- 37 C.F.R. 1.822. מוצג רק גדיל אחד מכל רצף חומצת גרעין, אך הגדיל המשלים מובן כלול בכל התייחסות לגדיל המוצג בטבלה 3 הבאה ו/או כפי שמופיע כאן:

crRNA עבור יעד SEQ ID NO: 132 כולל

crRNA עבור יעד SEQ ID NO: 108 כולל

Cpf1 crRNA אתרי יעד ואתרי PAM בתוך chr11: 67681215-67741765 כוללים

Cpf1 crRNA אתרי יעד ואתרי PAM בתוך chr11: 67805337-67845629 כוללים

אתרי המטרה של Cpf1 crRNA ואתרי PAM בתוך chr11: 67895738-67941098 כוללים:

בהתגלמויות מסוימות, רצף יעדים של Cpf1 crRNA כולל TTTGGAGCTGTTGGCATCATGTTCCTG (SEQ ID NO: 203) ו- crRNA למטרה כוללת

בהתגלמויות מסוימות, רצף יעדים של Cpf1 crRNA כולל TTTATCCAAACCTCCTAAATGATAC (SEQ ID NO: 210) הממוקם ב- chr11: 67839126-67839150, ו- crRNA למטרה כולל:

בהתגלמויות מסוימות, רצף יעדים של Cpf1 crRNA כולל TTTACACCCGATCCACTGGGGCA (SEQ ID NO: 212) הממוקם ב- chr3: 46373915-46373939, ו- crRNA למטרה כוללת

crRNAs תוכננו גם בהתבסס על רצף האתרים החתוך הבא של CRISPR/Cpf1 27 nt: TTTTTTGATTCTTTTCTATCTCAGGACA (SEQ ID NO: 213) הממוקם בתוך chr11: 67812443-67812469.

תבניות תיקון בהנחיית הומולוגיה ל- HDR תוכננו גם לזוגות מדריכי נוקלאז עם זרועות הומולוגיה סימטריות או אסימטריות כפי שתוארו על ידי ריצ'רדסון ואח ', Nat Biotechnol. 201634 (3): 339-44. כל תבנית תורם כללה זרועות הומולוגיות (תבנית תיקון מכוונת הומולוגיה) הצמודות לאלמנט ברקוד DNA אקראי של 20 bp למעקב אחר שיבוט, במעלה הזרם של מקדם פוספוגליצרט קינאז (PGK) אנושי (למשל, SEQ ID NO: 214) המניע ביטוי של ירוק משופר גן כתב חלבון ניאון (GFP) (למטרות ניסוי, אך דומה לרצף DNA טיפולי בשימוש קליני). חלבון Cpf1 הומאני סונתז על ידי יצרן מסחרי (Aldevron), והנחה את ה- RNA בשני שינויים, מרווח אטומי אוליגואטילן גליקול ותיול מסוף 3 ′ התקבל גם ממקור מסחרי (Integrated DNA Technologies). תבנית הומולוגיה חד-גדושית של הומולוגיה (ssODN) סונתזה גם על ידי יצרן מסחרי (Integrated DNA Technologies). לדוגמאות של רצפים כאלה, ראו איורים. 1, 3, 4 ו -16.

כפי שצוין, בהתגלמויות מסוימות, מערכות עריכת גנים למתן טיפול גנטי בתוך GSH יכללו מדריך RNA וגרעין. בהתגלמויות מסוימות ניתן להשתמש בתבניות של תורמים, במיוחד בעת ביצוע טיפול של רווח תפקוד או טיפול מדויק של אובדן תפקוד. בהתגלמויות מסוימות, מערכות עריכת גנים כוללות תבנית תיקון מכוונת הומולוגיה ורצף חומצת גרעין טיפולי.

כל המרכיבים המבוססים על חומצת הגרעין של מערכות עריכת גנים יכולים להיות חד-גדילים, גדילים כפולים, או שהם עשויים להיות בעלי תערובת של אזורים חד-גדילים וגדילים. לדוגמה, RNA מדריך או תבנית תורם עשויה להיות DNA חד-גדילי, RNA חד-גדילי, DNA דו-גדילי או RNA דו-גדיל. בהתגלמויות מסוימות תוך ניצול חלקיקים המתוארים במסמך זה, סופה של חומצת גרעין הרחוקה ביותר מפני השטח הננו -חלקיקי עשוי להיות מוגן (למשל מפני התדרדרות אקסנוקלאוליטית) בשיטות המוכרות לבעלי מקצוע בתחום. לדוגמה, ניתן להוסיף שאריות אחד או יותר של dideoxynucleotide למסוף 3 'של מולקולה לינארית ו/או oligonucleotides המשלימים את עצמם נקשרים לקצה אחד או לשני הקצוות. ראו למשל צ'אנג ואח '. (1987) פרו. Natl. Acad Sci USA 84: 4959-4963 Nehls et al. (1996) מדע 272: 886-889. שיטות נוספות להגנה על פולינוקלאוטידים אקסוגניים מפני התפרקות כוללות הוספת קבוצות אמינו סופיות ושימוש בהצמדות אינטרונאוקלאוטיד שונה, כגון למשל פוספורוטיאטים, פוספורמידטים ושאריות O-methyl ribose או deoxyribose. ניתן להשתמש ב- mRNA מהונדס כימית כדי להגביר את היציבות התאית, בעוד שניתן לשלב זרועות הומולוגיה אסימטריות ושינוי פוספורותיאט ב- ssODN לשיפור יעילות HDR. בהתגלמויות מסוימות תוך ניצול חלקיקים המתוארים במסמך זה, חומצות הגרעין עשויות להיות מוגנות מפני דחיות אלקטרוסטטיות (מבוססות מטען) על ידי, למשל, תוספת של מרווח סיכוך מטען. בהתגלמויות מסוימות, מרווח סיכוך מטען יכול לכלול מרווח של 18 אטומים אוליגו -אתילן גליקול (OEG) המתווסף לקצה אחד או לשני הקצוות. בהתגלמויות מסוימות, מרווח סיכוך מטען יכול לכלול מרווח 10-26 אטום אוליגואתילן גליקול (OEG) המתווסף לקצה אחד או לשני הקצוות.

תבניות תורמים יכולות להיות בכל אורך, למשל 10 נוקלאוטידים ומעלה, 50 נוקלאוטידים ומעלה, 100 נוקלאוטידים ומעלה, 250 נוקלאוטידים ומעלה, 500 נוקלאוטידים ומעלה, 1000 נוקלאוטידים ומעלה, 5000 נוקלאוטידים ומעלה וכו '.

בהתגלמויות מסוימות, תבנית תיקון מכוונת הומולוגיה מיועדת לשמש כתבנית של רקומבינציה הומולוגית, כגון בתוך או בסמוך לרצף מטרה שנקלט או נקטע על ידי אנזים (למשל, נוקלאז) של מערכת עריכת גנים. תבנית תיקון המיועדת להומולוגיה יכולה להיות בכל אורך מתאים, כגון 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, 2000, 3000, 4000, 5000 או יותר נוקלאוטידים. בהתגלמויות מסוימות, פולינוקלאוטיד התבנית המכוונת לתיקון הומולוגיה משלים לחלק מפולינוקלאוטיד כולל רצף המטרה. כאשר הוא מיושר בצורה אופטימלית, פולינוקלאוטיד של תבנית תיקון המכוונת להומולוגיה חופף לאחד או יותר נוקלאוטידים של רצף מטרה (למשל 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 או יותר נוקלאוטידים).

בהתגלמויות מסוימות, תבנית התיקון המכוונת להומולוגיה יכולה לכלול הומולוגיה מספקת לרצף גנומי באתר המחשוף, למשל. 70%, 80%, 85%, 90%, 95%או 100%הומולוגיה כאשר רצפי הנוקלאוטיד מקיפים את אתר המחשוף, למשל, בתוך 50 בסיסים או פחות מאתר המחשוף, למשל, בתוך 30 בסיסים, בתוך 15 בסיסים, בתוך 10 בסיסים, בתוך 5 בסיסים, או מיד מאגף את אתר המחשוף, כדי לתמוך ב- HDR בינו לבין הרצף הגנומי שאליו הוא נושא הומולוגיה. 25, 50, 100 או 200 נוקלאוטידים, או יותר מ -200 נוקלאוטידים של הומולוגית רצף בין תבנית תיקון מכוונת הומולוגיה לרצף גנומי ממוקד (או כל ערך אינטגרלי בין 10 ל -200 נוקלאוטידים או יותר) יכולים לתמוך ב- HDR. זרועות הומולוגיה או רצפים צלעים זהים בדרך כלל לרצף הגנומי, למשל לאזור הגנומי שבו מתרחשת ההפסקה הכפולה (DSB). עם זאת, לא נדרשת זהות מוחלטת.

בהתגלמויות מסוימות, תבנית התורם כוללת רצף חומצות גרעין טיפולי הטרוגולוגי המונח על ידי שני אזורי הומולוגיה, כך שתיקון מכוון הומולוגיה בין אזור ה- DNA היעד לבין שני רצפי האגף גורם להכנסת רצף חומצות הגרעין הטיפולי הטרוולוגי למטרה אזור.

בכמה דוגמאות, זרועות הומולוגיה או רצפים צמודים של תבניות תיקון המכוונות להומולוגיה הן א-סימטריות.

כפי שצוין, בהתגלמויות מסוימות, תבניות התורם כוללות רצף חומצות גרעין טיפולי. רצפי חומצה גרעין טיפוליים יכולים לכלול רצף גנים מתוקן רצף גנים שלם ו/או אלמנט רגולטורי אחד או יותר הקשורים לביטוי הגן. רצף גנים מתוקן יכול להיות חלק של גן הדורש תיקון או יכול לספק עותק חלופי מלא של גן. רצף גנים מתוקן יכול לספק עותק מלא של גן, מבלי להחליף בהכרח גן פגום קיים. אחד המקצוענים בתחום יזהה כי ייתכן שנדרשת הסרה של גן פגום בעת מתן עותק מתוקן. בעת הכנסת גן לנמל בטוח גנטי, רצף חומצות גרעין טיפולי צריך לכלול אזור קידוד ואת כל האלמנטים הרגולטוריים הנדרשים לביטויו.

דוגמאות לגנים טיפוליים ומוצרי גנים כוללים חלבון שלד 4.1, גליקופורין, p55, האלל Duffy, גני משפחת גלובין היה פוסט דיסטרופין פירובט קינאז CLN3 ABCD1 arylsulfatase A SFTPB SFTPC NLX2.1 ABCA3 GATA1 גנים חלבון ריבוזומלי TERT TERC DKC1 TINR2 PINK1 SNCA PSEN1 PSEN2 APP SOD1 TDP43 FUS ubiquilin 2 C9ORF72, α2β1 αvβ3 αvβ5 αvβ63 BOB/GPR15 Bonzo/STRL-33/TYMSTR CCR2 CCR3 CCRS CCR8 CD4 CD46 CD55 CXCR4 aminopeptid dystroglycan LDLR/α2MR/LRP PVR PRR1/HveC, קולטן למינין, 101F6, 123F2, 53BP2, abl, ABLI, ADP, aFGF, APC, ApoAI, ApoAIV, ApoE, ATM, BAI-1, BDNF, Beta*(BL) bFGF, BLC1, BLC6, BRCA1, BRCA2, CBFA1, CBL, C-CAM, CFTR, CNTF, COX-1, CSFIR, CTS-1, cytosine deaminase, DBCCR-1, DCC, Dp, DPC-4, E1A, E2F , EBRB2, erb, ERBA, ERBB, ETS1, ETS2, ETV6, Fab, FancA, FancB, FancC, FancD1, FancD2, FancE, FancF, FancG, FancI, FancJ, FancL, FancM, FancN, FancO, FancP, FancR , FancS, FancT, FancU, FancV ו- FancW, FCC, FGF, FGR, FHIT, fms, FOX, FUS 1, FUS1, FYN, G-CSF, GDAIF, Gene 21, Gene 26, GM-CSF, GMF, gsp, HCR, HIC-1, HRAS, hst , IGF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, ING1, אינטרפרון α, אינטרפרון β, אינטרפרון γ, IRF-1, JUN, KRAS, LCK, LUCA-1, LUCA-2, LYN, MADH4, MADR2, MCC, mda7, MDM2, MEN-I, MEN-II, MLL , MMAC1, MYB, MYC, MYCL1, MYCN, neu, NF-1, NF-2, NGF, NOEY1, NOEY2, NRAS, NT3, NT5, OVCA1, p16, p21, p27, p53, p57, p73, p300, PGS , PIM1, PL6, PML, PTEN, raf, Rap1A, ras, Rb, RB1, RET, rks-3, ScFv, scFV ras, SEM A3, SRC, TALI, TCL3, TFPI, thrombospondin, thymidine kinase, TNF, TP53, trk, T-VEC, VEGF, VHL, VVT1, WT-1, YES, zac1, iduronidase, IDS, GNS, HGSNAT, SGSH, NAGLU, GUSB, GALNS, GLB1, ARSB, HYAL1, F8, F9, HBB, CYB5R3, γC, JAK3, IL7RA, RAG1, RAG2, DCLRE1C, PRKDC, LIG4, NHEJ1, CD3D, CD3E, CD3Z, CD3G, PTPRC, ZAP70, LCK, AK2, ADA, PNP, WHN, CHD7, ORAI1, STIM1, CORO1A, RFXANK, RFX5, RFXAP, RMRP, DKC1, TERT, TINF2, DCLRE1B ו- SLC46A1.

בהתגלמויות מסוימות, גן טיפולי כולל רצף קידוד של מוצר ביטוי טיפולי (למשל, חלבון, RNA) וכל האלמנטים הרגולטוריים הקשורים (למשל, מקדמים וכו ') כדי להביא לביטוי של המוצר הגנטי.

בהתגלמויות מסוימות, ניתן לבחור רצף חומצות גרעין טיפולי (למשל, גן) לצורך שילוב ב- GSH כדי לספק בחירה in vivo של התא המהונדס גנטית. לדוגמה, בחירת in vivo באמצעות מתג צמיחת תאים מאפשרת להגדיל אוכלוסייה קטנה של תאים מהונדסים גנטית. אסטרטגיה להשגת בחירת in vivo הייתה שימוש בחירת תרופות תוך ביטוי משותף של טרנסגן המשדר כימורה, כגון O6-methylguanine-DNA-methyltransferase (MGMT). גישה חלופית היא הקניית פוטנציאל ריבוי מוגבר ל- HSC שעבר שינוי גנטי באמצעות אספקת גורם התעתוק של הומובוקס HOXB4. בהתגלמויות מסוימות ניתן לשלב גן התאבדות בתא מהונדס גנטית כך שניתן יהיה לחסל אוכלוסיית תאים כזו, למשל, על ידי מתן תרופה המפעילה את הגן המתאבד. ראו למשל סרטן ג'ין תר. 2012 19 באוגוסט (8): 523-9 PLoS One. 2013 8 (3): e59594. וטיפול מולקולרי - אונקוליטיקה (2016) 3, 16011.

התגלמויות מיוחדות כוללות יצירת קשר עם תא דם עם מערכת לעריכת גנים המסוגלת להכניס תבנית תורם לתאי דם מטרה GSH. בהתגלמויות מסוימות, מערכת עריכת הגנים כוללת crRNA המסוגל להכלאה לרצף מטרה בתוך ה- GSH, וחומצת גרעין המקודדת לאנזים נוקלאז כגון Cpf1 או Cas9. בהתגלמויות מסוימות, רצפי קידוד Cas9 או Cpf1 יכולים לכלול מספר מזהה SEQ: 215-227. בהתגלמויות מסוימות, רצפי חומצות אמינו Cas9 או Cpf1 יכולים לכלול מספר מזהה SEQ: 228-241.

בהתגלמות מופתית מסוימת, מערכת עריכת גנים מסוג Cpf1/crRNA תוכננה לכוון את המיקום chr11: 67812349-67812375 הנמל הבטוח הגנומי (GSH) (איור 1). תוצאות רצף סנגרים ב- K562 למיקום זה הבחינו במוטציה A & gtT ב- 15 bp לאחר אתר PAM (TTTG איור 2) שהביאה ליעילות חיתוך נמוכה יותר בשורת תאים זו בהשוואה לתאים CD34+. כמו כן הוכח כי יעילות החיתוך לאתר TTTA PAM גבוהה יותר מ- TTTG או TTTC. לכן, מיקום GSH נוסף זוהה בכרומוזום 11 (chr11: 67839126-67839150) עם אתר TTTA PAM שיכול להגביר את יעילות החיתוך (איור 3). בנוסף, מסך SNP במיקום זה לא זיהה SNP נפוץ. תוכננו גם תבניות תיקון המכוונות להומולוגיה. HTs מסונתזים היו 100 bp ssDNA הנושא אתר הגבלת NotI להערכת HDR (איורים 1 ו -3).

(III) חלקיקים. כפי שצוין קודם לכן, יש צורך בשיטות משלוח של מערכות עריכת גנים שאינן מסתמכות על אלקטרופורציה או וקטורים ויראליים. בנוסף לספק GSH ורכיבי עריכת גנים ממוקדים, הגילוי הנוכחי מספק גם חלקיקים מהונדסים המאפשרים אספקה ​​של רכיבי עריכת הגן. חלקיקי הננו מתוכננים לכלול את כל המרכיבים לעריכת גנים ממוקדים, למשל בתוך GSH. כאשר שימוש טיפולי צריך רק לנטרל את הגן הבעייתי, חלקיקי הננו צריכים להיות קשורים רק לאלמנט מכוון ולאלמנט חיתוך (אם כי רכיבים אחרים עשויים להיכלל כנדרש או מועיל למטרה מסוימת). כאשר שימוש טיפולי מוסיף או מתקן גן, חלקיקי הננו קשורים לאלמנט מיקוד, אלמנט חיתוך ותבנית תורם.

התגלמויות מיוחדות משתמשות בחלקיקי מתכת קולואידיים. מתכת קולואידית כוללת כל חלקיק מתכת בלתי מסיס או תרכובת מתכתית המפוזרת במים נוזליים. מתכת קולואידית יכולה להיות השעיה של חלקיקי מתכת בתמיסה מימית. ניתן להשתמש בכל מתכת שניתן ליצור בצורה קולואידית, כולל זהב, כסף, נחושת, ניקל, אלומיניום, אבץ, סידן, פלטינה, פלדיום וברזל. בהתגלמויות מסוימות משתמשים בחלקיקי זהב, למשל, מוכנים מ- HAuCl4. בהתגלמויות מסוימות, חלקיקי הננו הם חלקיקים שאינם מזהב המצופים זהב לייצור חלקיקים מצופים זהב.

שיטות לייצור חלקיקי מתכת קולואידיים, כולל חלקיקים קולוידאליים מזהב מ- HAuCl4, ידועים לבעלי מיומנות רגילה בתחום. לדוגמה, ניתן להשתמש בשיטות המתוארות במסמך זה ובשיטות המתוארות במקומות אחרים (למשל, ארה"ב 2001/005581 2003/0118657 ו- 2003/0053983) לייצור חלקיקים.

בהתגלמויות מופת במיוחד, AuNPs סונתזו בשלושה טווחי גדלים שונים (15, 50, 100 ננומטר) על ידי אופטימיזציה של טורקביץ 'ושיטות גידול זריעה (Shahbazi et al., Nanomedicine (Lond), 2017. 12 (16): p .1961-1973 Shahbazi, et al., ננוטכנולוגיה, 2017. 28 (2): עמ '025103 טורקביץ ואח'. של האגודה האמריקאית לכימיה, 2009. 131 (47): עמ '17042-17043). בשלב הראשון, AuNPs זרעים של 15 ננומטר סונתזו על ידי הבאת 100 מ"ל של פתרון זהב (III) כלוריד 0.25 מ"מ לכלוריד לנקודת הרתיחה והוספת 1 מ"ל של תמיסת מיובש טריזודיום ציטראט 3.33%. סינתזה של חלקיקים בוצעה במהירויות ערבוב גבוהות במשך 10 דקות. חלקיקים מוכנים מקוררו עד 4 מעלות צלזיוס והשתמשו בהם בשלב הצמיחה הבא.

על מנת להכין AuNPs בטווחי גודל של 50 ננומטר ו -100 ננומטר, הוכנו שני 100 מ"ל שונים של 0.25 מ"מ זהב (III) כלוריד טריהידראט ובתנאי ערבוב קלים התווספו 2440 µL ו -304 µL זרעי AuNPs בנפרד כדי לסנתז 50 ננומטר. ו- 100 ננומטר AuNPs, בהתאמה. לפתרונות אלה נוספה 1 מ"ל של תמיסת מיובש טריסודיום ציטראט 15 מ"מ והתערובת הובאה למהירות הבחישה הגבוהה ביותר. לאחר מכן, 1 מ"ל של פתרון 25 מ"מ הידרוקווינון נוספה והסינתזה נמשכה במשך 30 דקות במשך 50 ננומטר AuNPs ו- 5 שעות עבור 100 ננומטר AuNPs. לבסוף, חלקיקים מסונתזים טוהרו על ידי צנטריפוגה ב 5000 × גרם והתפזרים במים טהורים במיוחד.

בעוד AuNPs מתוארים במיוחד, חלקיקי ננו הכלולים בפרסום הנוכחי עשויים להינתן בצורות שונות, למשל כחלקיקים מוצקים (למשל מתכת כגון כסף, זהב, ברזל, טיטניום), מוצקים שאינם מתכתיים, מבוססי שומנים, פולימרים, השעיות של חלקיקים, או שילובים שלהם. ניתן להכין חלקיקים מתכתיים, דיאלקטריים ומוליכים למחצה, כמו גם מבנים היברידיים (למשל חלקיקי ליבה). חלקיקי ננו העשויים מחומר מוליך למחצה עשויים להיות מסומנים גם בנקודות קוונטיות אם הן קטנות מספיק (בדרך כלל תת -ננומטר בדרך כלל) כדי להתרחש כימות של רמות האנרגיה האלקטרונית. חלקיקים ננומטיים כאלה משמשים ביישומים ביו -רפואיים כנשאי תרופות או סוכני הדמיה ועשויים להיות מותאמים למטרות דומות בפרסום הנוכחי.

חלקיקים חלקים ומוצקים רכים יוצרו, והם בגדר הגילוי הנוכחי. חלקיק בעל אופי מוצק למחצה הוא הליפוזום. סוגים שונים של חלקיקי ליפוזום משמשים כיום קלינית כמערכות משלוח לתרופות וחיסונים נגד סרטן. חלקיקים עם חצי אחד הידרופילי והחצי השני הידרופובי מכונים חלקיקי יאנוס והם יעילים במיוחד לייצוב תחליב. הם יכולים להרכיב את עצמם בממשקי מים/שמן ולשמש כפעילי שטח מוצקים.

חלקיק ננו יכול לכלול כל חומר מתאים, למשל, חומר תואם ביולוגי. החומר התואם ביולוגי יכול להיות פולימר. פולימרים ננו -חלקיקים מתאימים כוללים פוליסטירן, גומי סיליקון, פוליקרבונט, פוליאוריטן, פוליפרופילן, פולימתילמתאקרילט, פוליוויניל כלוריד, פוליאסטרים, פוליאתרים ופוליאתילן.דוגמאות לפולימרים ספציפיים כוללים פולי (קפרולקטון) (PCL), פולימר אתילן ויניל אצטט (EVA), פולי (חומצה לקטית) (PLA), פולי (חומצה לקטית L) (PLLA), פולי (חומצה גליקולית) (PGA), פולי (חומצה לקטית-חומצה-גליקולית) (PLGA), פולי (חומצה לקטית-חומצה-גליקולית) (PLLGA), פולי (D, L-lactide) (PDLA), פולי (L-lactide) (PLLA ), פולי (D, L-lactide-co-caprolactone), poly (D, L-lactide-co-caprolactone-co-glycolide), poly (D, L-lactide-co-PEO-co-D, L- lactide), poly (D, L-lactide-co-PPO-co-D, L-lactide), polyalkyl cyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethyleneglycol, poly-L- חומצה גלוטמית, פולי (חומצות הידרוקסיות), פולי אנהידרידים, פוליאורתואסטרים, פולי (אסטר אמיד), פוליאמיד, פולי (אסתר אסתר), פוליקרבונט, פולי אלקילנים כגון פוליאתילן ופוליפרופילן, פוליאלקילן גליקולים כגון פולי (אתילן גליקול) (PEG), פוליאתילנימין (PEI), תחמוצות פוליאלקילן (PEO), טרפטלטים פוליאלקילן כגון פולי (אתילן טרפתלט), אלכוהולי פוליוויניל (PVA), אתרי פוליוויניל, אסטרים פוליוויניל כגון פולי (ויניל אצטט), פוליוויניל הלידים כגון פולי (ויניל כלוריד) (PVC), פוליוויניל פירולידון, פוליסילוקסנים, פוליסטירן (PS), פוליאוריטן, תאית נגזרת כגון אלקיל תאית, תאית הידרוקסי אלקיל, אתרים תאית, אסטרים של תאית, תאית ניטרו, הידרוקסי -פרופיל -תאית, קרבוקסימתיל -תאית, פולימרים של חומצות אקריליק, כגון פולי (מתיל (מת) אקרילט) (PMMA), פולי (אתיל (מת) אקרילט), פולי (בוטיל (מת) אקרילט), פולי (איזובוטיל) (מת) אקרילט), פולי (הקסיל (מת) אקרילט), פולי (איזודציל (מת) אקרילט), פולי (לאוריל (מת) אקרילט), פולי (פניל (מת) אקרילט), פולי (מתיל אקרילט), פולי ( isopropyl acrylate), poly (isobutyl acrylate), poly (octadecyl acrylate) וקופולימרים ותערובות שלהם, polydioxanone והקופולימרים שלו, polyhydroxyalkanoates, פוליפרופילן fumarate, polyoxymethylene, poloxamers, פולי (אורטו) אסטרים, פולי (חומצה בוטירית), פולי ( חומצה), פולי (לקטיד-קופרולקטון), טרימתילן קרבונט ופול yvinylpyrrolidone.

בהתגלמויות מסוימות, חלקיק הננו הוא חלקיק שומני. חלקיק שומנים יכול לכלול שומן אחד או יותר, ואחד או יותר מהפולימרים המפורטים לעיל.

תרכובות ליפידואיות שימושיות במיוחד גם בניהול רכיבי מערכת עריכת גנים. בהתגלמויות מסוימות, תרכובות ליפידואידיות של אמינו -אלכוהול משולבות עם רכיבי מערכת עריכת גנים שיימסרו לתא או לנושא ליצירת מיקרו -חלקיקים, חלקיקים, ליפוזומים או מיצלים. רכיבי מערכת עריכת הגנים שיימסרו על ידי החלקיקים, הליפוזומים או המיקלים עשויים להיות פולינוקלאוטיד, חלבון, פפטיד או מולקולה קטנה. ניתן לשלב תרכובות ליפידואידיות של אמינואלכוהול עם תרכובות ליפידואיות אמינו -אלכוהול אחרות, פולימרים (סינתטיים או טבעיים), חומרים פעילים, כולסטרול, פחמימות, חלבונים, שומנים וכו 'ליצירת חלקיקים.

כפי שמתואר באיור. 6, ניתן לבחור את גודל AuNP להשפיע על הפצה ביולוגית בגוף האדם. חלקיקים המתאימים לשימוש בחשיפה הנוכחית יכולים להיות בכל צורה ויכולים להיות בגודל של 5 ננומטר -1000 ננומטר, למשל, מ -5 ננומטר -10 ננומטר, 5-50 ננומטר, 5 ננומטר -75 ננומטר, 5 ננומטר -40 nm, 10 nm-30, או 20 nm-30 nm. חלקיקים ננו יכולים להיות גם בגודל של בין 10 ננומטר -15 ננומטר, 15 ננומטר -20 ננומטר, 20 ננומטר -25 ננומטר, 25 ננומטר -30 ננומטר, 30 ננומטר -35 ננומטר, 35 ננומטר -40 ננומטר, 40 ננומטר- 45 nm, או 45 nm-50 nm, 50 nm-55 nm, 55 nm-60 nm, 60 nm-65 nm, 65 nm-70 nm, 70 nm-75 nm 75 nm-80 nm, 80 nm-85 nm , 85 nm-90 nm, 90 nm-95 nm, 95 nm-100 nm, 100 nm-105 nm, 105 nm-110 nm, 110 nm-115 nm, 115 nm-120 nm, 120 nm-125 nm, 125 nm-130 nm, 130 nm-135 nm, 135 nm-140 nm, 140 nm-145 nm, 145 nm-150 nm, 100 nm-500 nm, 100 nm-150 nm, 150 nm-200 nm, 200 nm- 250 nm, 250 nm-300 nm, 300 nm-350 nm, 350 nm-400 nm, 400 nm-450 nm, or 450 nm-500 nm. בהתגלמויות מסוימות, חלקיקים גדולים מ- 550 ננומטר אינם נכללים. הסיבה לכך היא שחלקיקים או חלקיקים מצומצמים של & gt600 nm אינם מתאימים לספיגה סלולרית.

התגלמויות מיוחדות יכולות לכלול גם חלקיקים הקשורים למולקולות מיקוד. ניתן להשתמש במולקולות מיקוד כדי למקד את חלקיק הננו לתא ספציפי כך שניתן לשלוט בפעילות של מערכת עריכת הגנים באופן מרחבי או זמני. לדוגמה, ניתן לשלוט על הפעילות והיעד של מערכת עריכת הגנים על ידי מולקולת מיקוד שיש לה זיקה מחייבת לחלבון על פני התא או לרכיב סלולרי אחר.

בהתגלמויות מסוימות, מולקולות המיקוד כוללות נוגדנים או תחומים מחייבים שלהם המביאים למסירה סלקטיבית של חלקיקים לסוגי תאים נבחרים. בהתגלמויות מסוימות, אספקה ​​סלקטיבית היא בלעדית לאוכלוסיית תאים שנבחרה. בהתגלמויות מסוימות, לפחות 65%, 70%, 75%, 80%, 85%, 90%, 95%או 99%מהחלקיקים המנוהלים מועברים לאוכלוסיית תאים שנבחרה.

בהתגלמויות מסוימות, תחומים מחייבים כוללים ליגנדים של סמן תאים, ליגנדים של קולטן, נוגדנים, פפטידים, אפטמרים של פפטיד, חומצות גרעין, אפטמרים של חומצות גרעין, שפיצים או שילובים שלהם. בהקשר של ליגנדים המיועדים לתאים, תחומים מחייבים כוללים כל חומר הנקשר לחומר אחר ליצירת קומפלקס המסוגל לתמוך במסירה סלקטיבית.

כפי שצוין, "נוגדנים" הם דוגמה אחת לתחומים מחייבים וכוללים נוגדנים שלמים או שברי כריכה של נוגדן, למשל Fv, Fab, Fab ', F (ab')2, Fc ושברי Fv שרשרת אחת (scFvs) או כל שברים יעילים ביולוגית של אימונוגלובולין הנקשרים במיוחד למוטיב המתבטא בסוג תא נבחר. נוגדנים או שברי מחייב אנטיגן כוללים את כל הנוגדנים הפוליקלונליים או חלקם, נוגדנים חד שבטיים, נוגדנים אנושיים, נוגדנים הומניים, נוגדנים סינתטיים, נוגדנים כימיים, נוגדנים ביספציפיים, מיני גופים ונוגדנים ליניאריים.

נוגדנים ממוצא אנושי או נוגדנים הומניזיים הורידו או לא היו אימונוגניות בבני אדם ויש להם מספר נמוך יותר של אפיטופים לא אימונוגניים בהשוואה לנוגדנים שאינם אנושיים. נוגדנים ושבריהם בדרך כלל ייבחרו כבעלי רמת אנטיגניות מופחתת בנבדקים אנושיים.

בהתגלמויות מסוימות, HSCs ממוקדות למסירה סלקטיבית של חלקיקים. בהתגלמויות מסוימות, HSCs ממוקדות למסירה סלקטיבית עם תחומים מחייבים הקושרים באופן סלקטיבי CD34 ו- CD90. בהתגלמויות מסוימות, ניתן למקד את HSC למסירה סלקטיבית עם תחום מחייב אחד או יותר המחברים באופן סלקטיבי אנטיגנים ידועים המתבטאים על פני השטח של HSCs ו- HSPCs: CD34, CD46, CD90, CD133, Sca-1 ו/או CD117.

ניתן למקד תאי T בוגרים למסירה סלקטיבית עם תחומים מחייבים המחברים CD3 באופן סלקטיבי. ניתן למקד תאי T מופעלים למסירה סלקטיבית עם תחומים מחייבים המחברים באופן סלקטיבי 4-1BB (CD137), CD69 ו/או CD25. ניתן למקד תאי עוזר T למסירה סלקטיבית עם תחומים מחייבים המחברים CD4 באופן סלקטיבי. ניתן למקד תאי T ציטוטוקסיים למסירה סלקטיבית עם תחומים מחייבים המחברים CD8 באופן סלקטיבי. ניתן למקד את תאי T מסוג "זיכרון מרכזי" (או "TCM") למסירה סלקטיבית עם תחומים מחייבים המחברים באופן סלקטיבי את CD62L, CCR7, CD25, CD127, CD45RO ו/או CD95. ניתן למקד תא T ("זיכרון אפקטור" (או "TEM") למסירה סלקטיבית עם תחומים מחייבים המחברים באופן סלקטיבי את גרנזים B ו/או פרפורין. ניתן למקד לתאי T רגולטוריים ("TREG") למסירה סלקטיבית עם תחומים מחייבים הקושרים באופן סלקטיבי CD25, CTLA-4, GITR, GARP ו/או LAP. ניתן למקד תאי T "תמימים" למסירה סלקטיבית עם תחומים מחייבים המחברים באופן סלקטיבי את CD62L, CCR7, CD28, CD127 ו/או CD45RA.

ניתן למקד תאים קטלניים טבעיים (המכונים גם תאי NK, תאי K ותאי הרוצח) למסירה סלקטיבית עם תחומים מחייבים המחברים CD8, CD16 ו/או CD56 באופן סלקטיבי.

ניתן למקד מקרופאגים (ואת מבשריהם, מונוציטים) למסירה סלקטיבית עם תחומים מחייבים הקושרים באופן סלקטיבי CD11b, F4/80 CD68 CD11c IL-4Rα ו/או CD163.

ניתן למקד לתאים דנדריטים לא בוגרים (כלומר, הפעלה מוקדמת) למסירה סלקטיבית עם תחומים מחייבים הנקשרים באופן סלקטיבי: CD1a, CD1b, CD1c, CD1d, CD21, CD35, CD39, CD40, CD86, CD101, CD148, CD209, ו/או DEC-205.

ניתן למקד תאי B למסירה סלקטיבית עם תחומים מחייבים המחברים באופן סלקטיבי את CD5, CD19, CD20, CD21, CD22, CD35, CD40, CD52 ו/או CD80.

אנטיגן 1 (LFA-1) הקשור לתפקוד הלימפוציטים מתבטא בכל תאי T, תאי B ומונוציטים/מקרופאגים. בהתאם לכך, ליגנדים המיועדים לתאים יכולים לקשור LFA-1 להשגת משלוח סלקטיבי של חלקיקים לתאי T, תאי B ומונוציטים/מקרופאגים.

בהתגלמויות מסוימות, מולקולת מיקוד יכולה להגיב, כלומר מופעלת או לא מופעלת על ידי אפקטור שבתא או בתא. בהתגלמויות מסוימות, רכיבים אחרים בתוך רצף יכולים לכלול נוקלאוטידים רגולטוריים כגון אלמנט מקדם, RNA מפריע קטן או סיכת ראש או מיקרו רנ"א לשליטה בביטוי של גן אחר באותו התא, או ברקוד DNA למעקב סלולרי.

Aptamers עשוי להיות מתוכנן להקל על מסירה סלקטיבית, כולל משלוח על פני הממברנה התאית, לתאים תאיים, או לתוך הגרעין. מבנה כזה יכול לכלול, בנוסף לאדם אחד או יותר, או ללא אפטאמר כזה או יותר, קבוצה כזו כדי להפוך את המדריך למסור, מעורר או מגיב אליו (למשל הפעלה או לא ניתן לביטול על ידי) אפקטור נבחר, למשל מגיב לתנאים פיזיולוגיים רגילים או פתולוגיים, כולל ללא הגבלה pH, היפוקסיה, O2 ריכוז, טמפרטורה, ריכוז חלבון, ריכוז אנזימטי, מבנה שומנים, חשיפה לאור, הפרעה מכנית (למשל גלי אולטרסאונד), שדות מגנטיים, שדות חשמליים או קרינה אלקטרומגנטית. שיטות לייצור אפטמרים ולצמוד אפטמרים כאלה אל פני השטח של חלקיק ננו ידועים בתחום, ראה למשל Huang et al. אנאלי. Chem., 2008, 80 (3), עמ '567-572.

בהתגלמויות מסוימות, לרצף aptamer של RNA יש זיקה מחייבת לליגנד aptamer בתא או בתא. בהתגלמויות מסוימות, ליגנד האפטאמר נמצא על התא, למשל כך שהוא יהיה זמין לפחות בחלקו על הפנים החוץ-תאי או על צלע קרום התא. לדוגמה, ליגנד aptamer עשוי להיות חלבון על פני התא. לכן ליגנד האפטאמר עשוי להיות חלק אחד מחלבון היתוך, חלק אחד אחר של חלבון ההיתוך בעל עוגן ממברנה או תחום המקיף ממברנה. בהתגלמויות מסוימות, ליגנד האפטאמר נמצא בתא. לדוגמה, ליגנד האפטאמר עשוי להיות מופנם בתוך תא, כלומר בתוך (מעבר) לקרום התא, למשל בציטופלזמה, בתוך אברון (כולל מיטוכונדריה), בתוך אנדוסום או בגרעין. בהתגלמויות מסוימות, aptamer יכול לכלול רצף תבנית תורם, שיכול לכלול תבנית HDR ורצף חומצת גרעין טיפולי.

(IV) הצמדה של רכיבים פעילים לננו -חלקיקים. כפי שצוין, ניתן לחבר מגוון רחב של רכיבים פעילים לחלקיקים הנחשפים כאן לעריכת גנים ממוקדת. לדוגמה, חומצות גרעין המהוות מרכיבי מערכת לעריכת גנים ניתנות לצמידה ישירות או עקיף, וקוולנטית או לא -קוואלית, אל פני השטח של החלקיקים. לדוגמה, חומצה גרעין עשויה להיקשר באופן קוולנטי בקצה אחד של חומצת הגרעין אל פני השטח של החלקיק.

חומצות גרעין מצומדות לחלקיק הננו יכולות להיות באורך של מ- 10 נוקלאוטידים (nt) -1000 nt, למשל 1 nt-25 nt, 25 nt-50 nt, 50 nt-100 nt, 100 nt-250 nt, 250 nt- 500 nt, 500 nt-1000 nt או יותר מ 1000 nt. בהתגלמויות מסוימות, חומצות הגרעין ששונו על ידי הצמדה למקשר אינן עולה על 50 nt או 40 nt באורך.

כאשר מצמידים באופן עקיף באמצעות, למשל, מקשר מתערב, כל סוג של מולקולה יכולה לשמש כמקשר. לדוגמה, מקשר יכול להיות שרשרת אליפטית הכוללת לפחות שני אטומי פחמן (למשל 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 או יותר אטומי פחמן), וכן ניתן להחליף קבוצה פונקציונלית אחת או יותר, כולל קטון, אתר, אסטר, אמיד, אלכוהול, אמין, אוריאה, תיאוריאה, סולפוקסיד, סולפון, סולפונמיד ו/או דיסולפיד.

בהתגלמויות מסוימות המקשר כולל דיסולפיד בקצה החופשי (למשל הקצה שאינו מצומד ל- RNA המדריך) המחבר את פני הננו -חלקיקים. בהתגלמויות מסוימות, הדיסולפיד הוא C210 דיסולפיד, כלומר היא יכולה להיות שרשרת אליפטית המסתיימת בדיסולפיד הכוללת 2, 3, 4, 5, 6, 7, 8, 9 או 10 אטומי פחמן, אם כי ניתן לחזות שניתן להשתמש בשרשראות אליפטיות ארוכות יותר. בהתגלמויות מסוימות, הדיסולפיד הוא 3 פחמן דיסולפיד (C3 S — S). הקישורים יכולים להכיל קבוצות סולפידריל (SH) או קבוצות דיסולפיד (S -S) או מספר שונה של אטומי גופרית. בהתגלמויות מסוימות, ניתן להציג שינוי תיאול מבלי להשתמש במקשר. בהתגלמויות מסוימות, אנזים נוקלאז מועבר כחלבון המצורף מראש עם ה- RNA המדריך שלו (קומפלקס ריבונוקלאופרוטאין (RNP)). בניסוח זה, מולקולת ה- RNA המדריכה נקשרת לחלקיק הננו -אנזים נוקלאז, כברירת מחדל, יכולה להיות גם קשורה (ראו למשל איורים 7B ו -7 ד).

התקדמות אחת הנחשבת כאן היא היכולת לשנות רכיבי CRISPR לצורך הצמדה לחלקיקי ננו. הסיבה לכך היא שרוב השינויים ברכיבי CRISPR עלולים לפגוע ביעילות החיתוך. לדוגמה, Li et al. (הנדסת CRISPR-Cpf1 crRNAs ו- mRNAs כדי למקסם את יעילות עריכת הגנום. 2017. 1: עמ '0066) הצביע על כך שקצה ה- 5' של Cpf1 crRNA אינו בטוח לשינויים כלשהם מכיוון ששינויים כאלה גורמים לביטול מחייב ה- crRNA ל- Cpf1 נוקליז. כאן מופיע שינוי לקצה ה- 3 ′ של crRNA שאינו פוגע ביעילות החיתוך. בהתגלמויות מסוימות, בשלב הראשון של הצמידה לחלקיקי ננו, קצה ה- 3 ′ של ה- crRNA משתנה באמצעות מרווח הקסה-אתילנגליקול של 18 אטומים (18 רווח) ו -3 פחמן דיסולפיד (C3 S-S) לחיבור ה- crRNA ל- פני השטח של AuNPs.

בהתבסס על האמור לעיל, בהתגלמויות מסוימות, למשל כאשר חלקיק הננו כולל זהב, מקשר יכול להיות כל מולקולה המכילה תיאול. תגובה של קבוצת תיאול עם Au גורמת לקשר גופרי ( - S—) קוולנטי. ל- AuNP יש זיקה גבוהה לקבוצות תיול (—SH) ודיתיול (S — S) וקשרים חצי-קוולנטיים מתרחשים בין פני השטח של AuNP וקבוצות גופרית (Hakkinen, Nat Chem, 2012. 4 (6): עמ '443-455 ). בהתגלמויות מסוימות, ניתן להוסיף קבוצות תיול לחומצות גרעין כדי להקל על ההתקשרות אל פני השטח של AuNPs. גישה זו יכולה לשפר את ספיגת חומצת הגרעין ויציבותה (ראו, למשל, Mirkin, et al., A Nature, 1996. 382 (6592): עמ '607-609).

באמצעות שיטה דו-שלבית מותאמת של זריעה-צמיחה, AuNPs חד-חד-מפושטים סונתזו ב -3 טווחי גודל שונים (15 ננומטר, 50 ננומטר, 100 ננומטר) וחוברו עם Cpf1 crRNA ואנדונוקלאז (איורים 7 ב, 7 ד, 100). בגלל הדחייה האלקטרוסטטית החזקה בין המשטח הטעון שלילי ל- crRNA טעון שלילי קשה לצרף את ה- crRNA אל פני השטח של AuNPs ללא, למשל, שינוי התיאול. בהתגלמויות מסוימות, בשלב השני, לאחר טיהור ה- AuNPs מצומדות crRNA, מתווסף אנדונוקלאז Cpf1 ומודגר עם AuNPs מצומדות crRNA כדי להקל על קישורו לידית 5 ′ של ה- crRNA (Dong, et al., Nature, 2016. 532 (7600): עמ '522-526). המבנה הקומפקטי של הננו -פורמולציה המעוצבת המכיל הן crRNA והן אנדו -נוקלאז Cpf1 גורם לקונפורמציה המגבירה את היציבות כנגד סוכנים משפילים ומאפשרת את ספיגת הננו -פורמולציה AuNP/CRISPR על ידי תאים בשל מטען ניטרלי כולל (כלומר פוטנציאל זטה). אמנם ניתנה רלוונטיות מיוחדת לאופטימיזציה של הננו -פורמולציה המתפרסמת עבור CRISPR/Cpf1, אך אותו רעיון עשוי להיות מיושם על שיעורי CRISPR אחרים. כמו כן, יחד עם ה- crRNA ו- Cpf1 endonuclease, ניתן לחבר 18 DNA spacer שונה חד גדילי (ssDNA) אל פני השטח של AuNPs כדי להשיג ננו -פורמולציה חדשה במטרה לשמש בתיקון מכוון הומולוגיה (HDR).

בהתגלמויות מסוימות, ניתן להוסיף מקשר spacer-thiol לאחד מחלבוני Cpf1 או Cas9 עצמם או לגרסאות מהונדסות של האמור (למשל, כפי שמתואר להלן), על ידי הוספת שאריות ציסטאין על N- או C- הקצה . לאחר מכן ניתן להוסיף את חלבון הגרעיניז כשכבה ראשונה על פני שטח חלקיקי הזהב. מקשר spacer-thiol זה יכול להגביר את יציבות החלבון ולהגדיל את יעילות החיתוך. בהתגלמויות מסוימות, קומפלקס RNA נוצר בין crRNA לגרעינים ולאחר מכן מחובר אל פני השטח של חלקיקי זהב באמצעות מקשר spacer-thiol.

כפי שצוין קודם לכן, הוספת רכיבי עריכת גנים ממוצא חיידקי כשלב טעינה ראשון יכולה לספק מיגון מועיל של רכיבים אלה לאחר מתן לנבדק בעל חסינות קיימת מראש לרכיב. המיגון יכול לנבוע מרכיבים אחרים לעריכת גנים (למשל, תבניות תורם) ואין צורך להסתמך על מעטפת פולימרית מגוננת. בהתגלמויות מסוימות, מעטפת פולימרית אינה נכללת. בהתגלמויות מסוימות, המיגון עשוי לאפשר ניהול סדרתי in vivo.

בהתגלמויות מסוימות, ניתן להוסיף crRNAs ל- AuNPs ביחסי AuNP/crRNA w/w שונים (0.25, 0.5, 1, 1.5, 2, 3, 4, 5, 6) ולערבב. ניתן להוסיף למאגר ציטראט עם pH של 3 לתערובת בריכוז של 10 מ"מ כדי לסנן את הדחייה השלילית בין crRNA טעון שלילי ל- AuNP. לאחר ערבוב במשך 5 דקות, חלקיקים ניתנים לצנטריפוגה למטה וניתן לדמיין את ה- crRNA הבלתי מאוגד על ידי אלקטרופורזה של ג'ל agarose. לאחר קביעת ריכוז הצמידה האופטימלי, ניתן להוסיף 1 µL של 63 מיקרומטר Cpf1 נוקלאז לפתרון AuNP/crRNA ולדגירה למשך 20 דקות.

חשוב לציין, השימוש במאגר ציטראט מספק יתרונות משמעותיים בייצור. שיטות קודמות הסתמכו על השימוש ב- NaCl כדי לבדוק את משטח החלקיקים הטעונים שלילית ולהפחית דחייה של DNA טעון שלילי באופן דומה. עם זאת, NaCl יכול לגרום לצבירה בלתי הפיכה של חלקיקי זהב, ולכן יש להוסיף אותה בהדרגה לאורך זמן עם שינויים ריכוזיים מצטברים. באופן כללי, יש להוסיף NaCl במשך 48 שעות כדי למנוע צבירה. כאשר נעשה שימוש במאגר ציטראט עם pH של 3, כריכה זו יכולה לקרות ביעילות גבוהה יותר תוך פחות מ -3 דקות. ג'אנג ואח '. (2012). Journal of the American Chemical Society 134 (17): 7266-7269 הפחתת עלות הסחורות והזמן במתקן הייצור של GMP.

גודל ומורפולוגיה של ננו -פורמולציות מוכן AuNP/CRISPR ניתן לאפיין על ידי הדמיה תחת מיקרוסקופ אלקטרונים הילוכים (TEM). ניתן להוסיף AuNPs (4 μL) לרשתות נחושת ולאפשר להתייבש למשך הלילה. ההדמיה מתבצעת ב -120 קילו וולט.

ניתן לדמיין ציפוי CRISPR על ידי מיקרוסקופ אלקטרונים מכתים שלילי.ניתן להכתים את ננו -פורמולציה AuNP/CRISPR ב -0.7% פורניל אורניל ו -2% אורניל אצטט, בהתאמה. ניתן להוסיף מדגם מוכתם (4 µL) לרשת נחושת מצופה פחמן ולדגירה למשך דקה אחת ולמחוק בפיסת נייר סינון. לאחר שלושה מחזורי כביסה עם פתרון כתמים של 20 μl, ניתן להוסיף פתרון של כתמי 4 μl לרשתות ולמחוק ולייבש באוויר.

כמו כן, ניתן לאפיין ננו-פורמולציות AuNP/CRISPR על ידי ספקטרופוטומטר גלוי ל- Nanodrop UV על ידי ניתוח השינויים בשיא תהודה פלסמונית (LSPR) מקומית של AuNPs לפני ואחרי הצמדה עם רכיבי CRISPR.

בהתגלמויות מסוימות, חלקיק ננו -חלקיק מרובד, כגון במהלך הסינתזה לכלול PEI או פולימר טעון חיובי אחר להגדלת שטח הפנים וחיבור ssDNA גדול יותר או מולקולות אחרות, כגון מולקולות מיקוד ו/או תבניות תורם גדולות (ראה, למשל, איור .7 ג). ניתן להכין ננו -פורמולציה בצורת שכבה אחר שכבה וניתן להשתמש בפולימרים טעונים חיוביים (כגון PEI במשקלים וצורות מולקולריים שונים) לציפוי המשטח הטעון שלילי של חלקיקי זהב או חלקיקי זהב מצופים CRISPR כדי לצרף רכיבים של עריכת גנים. ורכיבים אחרים (כגון תחומים המחייבים נוגדנים). שכבות למעשה מגדילה את שטח הפנים של החלקיקים הזמינים עבור מולקולות מצומדות כגון אוליגנונוקליאוטידים גדולים עם או בלי חלבונים אחרים.

בהתגלמויות מסוימות ניתן להוסיף PEI כשכבה שנייה ולהוסיף ssDNA כשכבה שלישית. לחלופין, ניתן לשנות את שלבי הצמידה על ידי הוספת ssDNA כשכבה שנייה ו- PEI כשכבה שלישית. בהתגלמויות מסוימות, PEI, פולימרים ו- ssDNA אינם כלולים כשכבה ראשונה, שכן ניתן לשמור שכבה זו עבור מתחמי RNP המחוברים לקשרים.

בהתגלמויות מסוימות, ננו-פורמולציה רב שכבתית של הגילוי היא בגודל ממוצע של 25-30 ננומטר והיא חד-פיזורית מאוד. תמונות מיקרוסקופ אלקטרונים הילוכים (TEM) ומשמרות תהודה פלסמונית על פני שטח (LSPR) של חלקיקי זהב (AuNPs) הראו ציפוי משטח אחיד ללא צבירה (איורים 9 א, 9 ב). בהתחשב באופי הסינתטי של כל מערכת האספקה, ניתן להרכיב את כל הרכיבים תוך מספר שעות, בניגוד לגישות קודמות שדרשו מספר ימים עקב שימוש ב- NaCl כמסך טעינה.

כפי שמוצג באיורים. 7D ו- 9A, חלקיקים מסונתזים היו ציפוי חד -חדדי ומוצלח ביותר של 4 ננומטר ללא כל צבירה שהושגה מה שהגדיל את גודל החלקיקים ל -54 ננומטר לאחר ציפוי של 50 ננומטר AuNPs. כמו כן, ירידה בעוצמה ובשינוי האדום של פלסמון השטח המקומי (LSPR) של AuNPs הראתה את הצמידה המוצלחת עם רכיבי CRISPR ללא צבירה (איור 9 א). כמו כן, מחקרי העמסת oligonucleotide עם דגם 18 spacer C3 S -S שונה ב- ssDNA ביחסי AuNP/ssDNA w/w שונים הראו כי היחס בין 6 הוא אופטימלי לביצוע הצמידה (איור 9C). באמצעות יחס טעינה אופטימלי זה crRNA נטען על פני השטח של AuNPs בריכוז 30 מיקרוגרם/מ"ל (איור 9 ד). נתונים אלה עוזרים לחשב את מינון היישום המדויק ללימודי עריכת גנים.

הגישות המתוארות הביאו לנונו-פורמולציה ננו-פורמלית CRISPR בעלת עוצמה רבה המסוגלת לספק הן סינתטי, שאינו שונה כימית CRISPR Cpf1 או CRISPR Cas9 ribonucleoproteins יחד עם תבנית הומולוגיה של ssDNA להכנסת DNA חדש, ללא צורך באלקטרופורציה (איור 7 ד) ). בהתגלמויות מסוימות, הגודל ההידרודינמי של AuNP טעון במלואו הוא 150-190 ננומטר, 160-185 ננומטר, 170-180 ננומטר או 176 ננומטר.

(V) יעילות עריכת גנים. הריכוזים האופטימליים של crRNA, hAsCpf1 RNA ו- ssODN לאלקטרופורציה נקבעו בתאי K562. הריכוז האופטימלי מציג את הכדאיות והביטוי GFP הגבוה ביותר. תאי K562 הורבבו ב -24 צלחות בארות בריכוז 1 × 10 5 תאים/באר. המדיום של IMC של Dulbecco (IMDM) של איסקוב עם 10% FBS ו- 1% PenStrep שימש לתרבית התאים. תאים CD34+ היו מתורבתים בלוחות 24 בארות בריכוז 5 × 10 5 תאים/באר. תנאי התרבות לתאים CD34+ היו זהים לתאי K562 עם גורמי גדילה נדרשים. ננו -פורמולציות AuNP/CRISPR נוספו בריכוז של 25 ננומטר לבארות ויעילות העריכה הוערכה לאחר דגירה של 48 שעות. אלקטרופורציה של התאים בוצעה באמצעות מערכת אלקטרופורציה של Wave ECV 830 Square Wave Harvard Apparatus באמצעות פתרון BTX Express (ארה"ב). בקוביות של 1 מ"מ תוך משך דופק של 250 וולט ו -5 אלפיות השנייה. קוביות BTX 1 מ"מ עם רוחב פער של 2 מ"מ שימשו לאלקטרופורציה של 1-3 מיליון תאים K562 ב -250 וולט למשך 5 מילי שניות. תאים הושעו מחדש בתקשורת התרבות ונותחו בעקבות אלקטרופורציה.

AuNP/CRISPR ננו-פורמולציות הממוקדות למיקום chr11: 67812349-67812375 הצליחו לחתוך בהצלחה את אתר היעד בריכוזים נמוכים מאוד של crRNA ו- Cpf1 אנדונוקלאז (25 ננומטר) בהשוואה לשיטת אלקטרופורציה בה נעשה שימוש בכמות גבוהה יותר של crRNA ו- Cpf1 (126 nM) (איור 12 א) כדי להשיג את אותה יעילות של חיתוך. יעילות החיתוך לאתר זה הייתה נמוכה עקב המוטציה A & gtT 15 bp לאחר אתר ה- PAM (איור 2). בבדיקה הבאה, אותו המיקוד היה ממוקד בתאי CD34+ ראשוניים והוכח כי ננו -פורמולציות AuNP/CRISPR הצליחו למקד לאתר בריכוזים מאוד נמוכים של crRNA ו- Cpf1 עם יעילות חיתוך טובה מאוד מבלי להעלות השפעות רעילות (איורים 12B, 12C ו- 14). לרוע המזל, אלקטרופורציה של תאי ה- CD34+ הראשוניים השפיעה לרעה על הכדאיות של התאים ולא נראתה חיתוך של תאים חשמליים. הריכוז המחושב עבור ננו -פורמולציה AuNP/CRISPR היה נמוך פי 5 מהריכוז הנדרש לשיטת אלקטרופורציה (איור 12 ד). כפי שצוין בעבר על ידי קים ואח '. (Nat Biotechnol, 2016. 34 (8): עמ '863-8), שיעור המחיקות להוספות היה גבוה יותר עם מערכת עריכת הגן CRISPR Cpf1 (איור 14).

כפי שמוצג באיור. 16, משלוח גנים בתיווך AuNP משפר את ביצועי Cas9, עם זאת, Cpf1 טוב יותר עבור HDR. תאים שטופלו ב- AuNP הפגינו כדאיות גבוהה יותר בהשוואה לתאים electroporated. עבור Cas9, משלוח בתיווך AuNP שיפר את העריכה הכוללת ו- HDR ביחס לאלקטרופורציה. עבור Cpf1 שנמסר ללא תבנית תיקון מכוונת הומולוגיה (HDT), אלקטרופורציה גרמה לעריכה גנטית הכוללת (indels). זה מצביע על כך שהאלקטרופורציה עצמה עשויה להשפיע על מסלול התיקון המשמש או על תדירות חיתוך Cpf1 באתר היעד. הוספת HDT לנוסח Cpf1 שיפרה את העריכה הכוללת והביאה לשיעורי HDR הגבוהים ביותר. יחד, נתונים אלה מצביעים על כך שהניסוח הטעון במלואו של AuNP+Cpf1/crRNA+HDT מביא לשיעורי HDR הגבוהים ביותר עם היווצרות אינדל מינימאלית. זה אידיאלי למספר מוקדי יעד לעריכת גנים.

מיקרוסקופיה קונפוקלית הוכיחה כי ננו -פורמולציות שנחשפו נמנעו מלכוד ליזוזומלי והתמקמו בהצלחה לגרעין התאים המטופויאטיים CD34 + ראשוניים מתורמים בריאים. תדירות הכניסה של עד 10% הודגמה באמצעות תבנית אנזים הגבלת NotI עם אורכי זרוע הומולוגיים של ± 40 נוקלאוטידים לאתר CCR5 ללא ציטוטוקסיות. עיצוב התבנית לגדיל ה- DNA שאינו מטרה הניב יעילות תיקון (HDR) מכוונת הומולוגיה גבוהה יותר (איור 13), עם להקות חתוכות ברורות של 447 bp ו- 316 bp בעקבות עיכול עם אנזימים NotI ו- T7E1 (איור 20B). השוואה ישירה של פעילות ה- nuclease של Cpf1 ו- Cas9 באותו אתר יעד CCR5 הוכיחה הטיה של Cpf1 ל- HDR ולתבנית על תבניות על Cas9, אשר יצרו באופן קבוע אינדלים. השתלת זן של תאי CD34 + אנושיים שטופלו ב- CRISPR Cpf1 אנושי שטופלו ב- CD34 + לעכברים חסרים במערכת החיסון הראתה מגמת עלייה מוקדמת ב- engraftment בהשוואה לתאים שאינם מטופלים, דבר המצביע על יתרון לא ידוע של HSPCs שטופלו בננו-פורמולציה. התדירות של engraftment תאים מהונדסים גנטית הייתה זהה לזה שנצפתה בתרבות, כאשר 10% מהתאים האנושיים הציגו תוספת תבנית NotI in vivo.

(VI) תרכובות ננו -חלקיקים וניסוחי תאים. חלקיקים ננו המפורטים במסמך זה ניתנים לניסוח לקומפוזיציות לניהול לנבדקים.

בהתגלמויות מסוימות, ניתן להשיג תאי דם מאדם או מתורם ולשנות גנטית (למשל בתוך GSH) לפני מתן הנבדק לטיפול במצב. מקורות נפוצים של תאי דם מתאימים כוללים דגימות דם היקפיות מגויסות, דגימות מוח עצם ו/או דם טבורי.

נשאים מופתיים לתרכובות ננו-חלקיקים ו/או ניסוחים של תאים כוללים מלוחים, מלוחים שנאגרו, מלוחים פיזיולוגיים, מים, תמיסת הנקס, תמיסת רינגר, נונוסול-ר (Abbott Labs), Plasma-Lyte A® (Baxter Laboratories, Inc., Morton Grove , איור), גליצרול, אתנול ושילובים מהם. בהתגלמויות מסוימות, תרכובות ננו -חלקיקים ו/או ניסוחי תאים ניתנות לנבדקים בהקדם האפשרי סביר לאחר ניסוחן הראשוני.

בהתגלמויות מסוימות, ניתן להשלים נשאים באלבומין בסרום אנושי (HSA) או ברכיבי סרום אנושיים אחרים או בסרום שור עוברי או ברכיבי סרום מסוגים אחרים. בהתגלמויות מסוימות, מנשא עירוי כולל תמיסת מלח שנאגרו עם 5% HSA או דקסטרוז. סוכנים איזוטוניים נוספים כוללים אלכוהולי סוכר פוליהידריים כולל אלכוהול סוכר טריהידרי או גבוה יותר, כגון גליצרין, אריתריטול, ערביטול, קסיליטול, סורביטול או מניטול.

נשאים יכולים לכלול סוכני חוצצים, כגון מאגרי ציטראט, מאגרי סוקסינאט, מאגרי טרטרט, מאגרי פומרט, מאגרי גלוקונאט, מאגרי אוקסלט, מאגרי לקטט, מאגרי אצטט, מאגרים פוספטים, מאגרי היסטידין ו/או מלחי טרימתילמין.

מייצבים מתייחסים לקטגוריה רחבה של חומרים עזר שיכולים לנוע בתפקודם בין חומר לתפזורת לתוסף המסייע במניעת הדבקות רכיבים לדפנות המיכל. מייצבים אופייניים יכולים לכלול חומצות אמינו של אלכוהולי סוכר פוליהידריים, כגון ארגנין, ליזין, גליצין, גלוטמין, אספרגין, היסטידין, אלאנין, אורניטין, L-leucine, 2-פנילאלנין, חומצה גלוטמית וסוכרים אורגניים תראונין או אלכוהול סוכר, כגון לקטוז. , טרכלוז, סטאכיוז, מניטול, סורביטול, קסיליטול, ריביטול, מיואיניסיטול, גלקטיטול, גליצרול וציקליטולים, כגון פולימרים של חומצות אמינו אינוזיטול PEG כגון אוריאה, גלוטתיון, חומצה תיוקטית, נתרן תיוגליקולאט, אלוגליצרול, -מונוטיוגליצרול, ונתרן תיוסולפט פוליפפטידים בעלי משקל מולקולרי נמוך (כלומר, & lt10 שאריות) חלבונים כגון HSA, אלבומין בסרום בקר, ג'לטין או אימונוגלובולינים פולימרים הידרופיליים כגון חד -סוכרים פוליוויניל -פירולידון כגון קסילוז, מאנוזה, פרוקטוז וגלוקוז דיסכרידים, כגון לקטוז, סוכרוז טריסכרידים כגון רפינוזה ופוליסכרידים כגון דקסטרן.

במידת הצורך או מועיל, תרכובות ננו -חלקיקים ו/או ניסוחים של תאים יכולים לכלול הרדמה מקומית כגון לידוקאין כדי להקל על הכאב באתר ההזרקה.

כמויות יעילות מבחינה טיפולית של חלקיקי ננו בתוך הרכב יכולים לכלול לפחות 0.1% חלקיקים w/v או w/w לפחות 1% w/v או w/w חלקיקים לפחות 10% w/v או w/w חלקיקים לפחות 20% חלקיקים w/v או w/w לפחות 30% w/v או w/w חלקיקים לפחות 40% w/v או w/w חלקיקים לפחות 50% w/v או w/w חלקיקים לפחות 60% w/w חלקיקי v או w/w לפחות 70% w/v או w/w חלקיקים לפחות 80% w/v או w/w חלקיקים לפחות 90% w/v או w/w חלקיקים לפחות 95% w/v או חלקיקי w/w או לפחות 99% w/v או w/w חלקיקים.

כמויות תאיות יעילות של תאים בתוך ניסוחים המבוססים על תאים יכולים להיות גדולים מ -10 2 תאים, גדולים מ -10 3 תאים, יותר מ -10 4 תאים, יותר מ -10 5 תאים, יותר מ -10 6 תאים, יותר מ -10 7 תאים, גדולים מ- 10 8 תאים, יותר מ -10 9 תאים, יותר מ -10 10 תאים, או יותר מ -10 11 תאים.

ניתן להכין את תרכובות הננו -חלקיקים ו/או ניסוחי התא המתוארים כאן לניהול על ידי למשל הזרקה, עירוי, זילוף או שטיפה.

בהתגלמויות מסוימות, זה יכול להיות נחוץ או מועיל להקפיא ייבוש של חלקיקים ננו-חלקיקים ו/או לשמירת קריסה של ניסוח מבוסס תאים. טכניקות כאלה ידועות לבעלי מקצוע רגילים בתחום.

(VII) שיטות שימוש ומופת. תאי גזע המטופויאטיים (HSC) הם תאי גזע שיכולים לגרום לכל סוגי תאי הדם כגון תאי הדם הלבנים של המערכת החיסונית (למשל, תאי T נלחמים בנגיפים ותאי B המייצרים נוגדנים) ותאי דם אדומים. ניתן להשתמש במינון הטיפולי של HSC לטיפול במגוון מצבים שליליים, כולל מחלות של חוסר חיסון, הפרעות דם, סרטן ממאיר, זיהומים וחשיפה לקרינה (למשל, טיפול בסרטן, במקרה או בהתקפה). כדוגמאות, יותר מ -80 מחלות מחסור חיסוניות עיקריות מוכרות על ידי ארגון הבריאות העולמי. מחלות אלו מאופיינות בפגם מהותי במערכת החיסון שבה, במקרים מסוימים, הגוף אינו מסוגל לייצר נוגדנים כלשהם או מספיק כנגד זיהום. במקרים אחרים, ההגנה הסלולרית למאבק בזיהום אינה פועלת כראוי. בדרך כלל, ליקויים חיסוניים ראשוניים הם הפרעות תורשתיות.

דוגמאות למחלות שניתן לטפל בהן באמצעות תרכובות הננו -חלקיקים או ניסוחי התא של הגילוי כוללות הפרעת דם מונוגנטית, המופיליה, מחלת גרייב, דלקת מפרקים שגרונית, אנמיה מזיקה, טרשת נפוצה, מחלת מעי דלקתית, זאבת מערכתית (SLE) , תסמונת וויסקוט-אולדריך (WAS), מחלת גרנולומטית כרונית (CGD), מחלת Battens, אדרנולוקודיסטרופיה (ALD) או לוקודיסטרופיה מטאכרומטית (MLD), ניוון שרירים, פרוטנוזיס אווולרי ריאתי (PAP), מחסור בפירובאט קינאז, שוואכמן-יהלום , dyskeratosis congenita, סיסטיק פיברוזיס, מחלת פרקינסון, מחלת אלצהיימר, טרשת לרוחב amyotrophic (מחלת לו גריג), לוקמיה לימפובלסטית חריפה (ALL), לוקמיה מיאלוגנית חריפה (AML), מטאפלזיה מיגנואית אגנוגית, טרמבוציטסיה, אמגאקריוציטוזה/טרומבוצגיה, תלסמיה גדולה, CLL, לוקמיה מיאלוגנית כרונית (CML), לוקמיה מיאלומונוציטית כרונית, וריה שכיחה מחסור חיסוני ble (CVID), הפרעות משלימות, אגמגלובולינמיה מולדת (מקושרת X), לימפוהיסטיוציטוזיס משפחתי אריתרופגוציטי, לימפומה של הודג'קין, תסמונת הרר, היפר IgM, חסר תת-כיתה IgG, לוקמיה מיאלומונוציטית צעירה, מוקופוליסכרידוזות, מיאלומה של לימפומה , המוגלובינוריה לילית פראוקסימלית (PNH), מחלות חיסוניות ראשונות עם מחסור בנוגדן, אפלזיה של תאים אדומים טהורים, אנמיה עקשן, מחסור סלקטיבי ב- IgA, אנמיה אפלסטית חמורה, SCD ו/או מחסור ספציפי בנוגדן.

התגלמויות מיוחדות כוללות טיפול בזיהומים חיידקיים ו/או טפיליים. טפיל אחד למופת כולל מחלת מלריה פלסמודיום.

ניתן להשתמש בתרכובות ובתכשירים המפורטים כאן לטיפול בנבדקים (בני אדם, בעלי חיים וטרינריים (כלבים, חתולים, זוחלים, ציפורים וכו '), בעלי חיים (סוסים, בקר, עזים, חזירים, תרנגולות וכו') ובעלי חיים ( קופים, חולדות, עכברים, דגים וכו '). בהתגלמויות מסוימות הנבדקים הם חולים אנושיים. ניתן להתאים אישית חלקיקים המתוארים כאן לכל מטרה בעוד שאתרי GSH ספציפיים לבני אדם ולפרימטים לא אנושיים.

הטיפול בנבדקים כולל מתן כמויות יעילות מבחינה טיפולית. כמויות יעילות טיפוליות כוללות את אלה המספקים כמויות יעילות, טיפולים מונעים ו/או טיפולים טיפוליים.

"כמות יעילה" היא כמות הניסוח הדרושה כדי לגרום לשינוי פיזיולוגי רצוי בנושא. כמויות אפקטיביות ניתנות לרוב למטרות מחקר.

מבחן לפונקציונליות של HSPC. הבדיקה החזקה ביותר עבור פונקציונליות HSPC היא היכולת לבנות מחדש hematopoiesis אצל נמען מותנה. בהתגלמויות מסוימות, HSPC אנושי מושתלים לאחר שידור לאחר אלקטרופורציה של עכברים אופטימליים של CRISPR/Cpf1 ושילוב ssODN לעכברי NOD/SCIDgamma null (NSG) תת-קטלניים. ההמטולוגיה, השריפה וההתמדה של תאי GFP + מנוטרים לאחר מכן על ידי cytometry זרימה על פני שושלות תאי הדם והזמן למשך 20 שבועות לאחר ההשתלה. DNA גנומי (gDNA) מבודד גם הוא מדם, BM וטחול של בעלי חיים שהושתלו בזמן הפקדה לצורך רצף ברקוד DNA כדי לקבוע את מספר המשובטים התורמים להמטופויזה של תאי GFP + שנצפו in vivo. בעלי חיים המקבלים HSPC ששונו עם CRISPR/Cpf1 ו- ssODN מנוטרים לתאי GFP + על ידי cytometry זרימה על פני שושלות תאי הדם והזמן. DNA גנומי (gDNA) מבודד מדם, BM וטחול של בעלי חיים שהושתלו בזמן פקודה לצורך רצף ברקוד DNA כדי לקבוע את מספר השיבוטים התורמים להמטופואזיס של תאי GFP + שנצפו in vivo, בנוסף להערכה יסודית יותר של היווצרות אינדל. והתמדה.

"טיפול מונע" כולל טיפול הניתן לנבדק שאינו מציג סימנים או תסמינים של מצב שיש לטפל בו או מציג רק סימנים מוקדמים או סימפטומים של המצב שיש לטפל בו כך שהטיפול ניתנת במטרה להפחית, למנוע , או הפחתת הסיכון לפתח את המצב. לפיכך, טיפול מונע מתפקד כטיפול מונע נגד מצב.

"טיפול טיפולי" כולל טיפול הניתן לנבדק המציג סימפטומים או סימנים של מצב והוא מנוהל לנבדק לצורך הפחתת חומרת המצב או התקדמותו.

המינון והכמות בפועל של הרכב או ניסוח טיפולי הניתנים לנבדק מסוים יכולים להיקבע על ידי רופא, וטרינר או חוקר תוך התחשבות בפרמטרים כגון גורמים פיזיים ופיזיולוגיים, כולל סוג גוף המטרה של חומרת המצב חומרת המצב באירועים רלוונטיים הקרובים , כאשר ידוע על התערבויות טיפוליות קודמות או במקביל אידיופתיה של הנושא ונתיב הניהול, למשל. בנוסף, ניתן להשתמש במבחני in vivo ובמבחני vivo בכדי לסייע בזיהוי טווחי המינון האופטימליים.

ניתן לתת כמויות יעילות מבחינה טיפולית בכל דרך מתן מתאימה כגון, הזרקה, עירוי, זילוף או שטיפה.

בהתגלמויות מסוימות, שיטות הגילוי הנוכחי יכולות לשחזר את תפקוד BM אצל אדם הזקוק לכך. בהתגלמויות מסוימות, שחזור תפקוד BM יכול לכלול שיפור אוכלוסיית BM מחדש עם תאים המתוקנים על ידי גן בהשוואה לנבדק הזקוק לכך שלא ניתן לו טיפול המתואר כאן. שיפור אוכלוסיית BM מחדש עם תאים המתוקנים בגן יכול לכלול הגדלת אחוז התאים המתוקנים בגן. בהתגלמויות מסוימות, התאים נבחרים מתאי דם לבנים ותאים שמקורם ב- BM.בהתגלמויות מסוימות, ניתן למדוד את אחוז התאים המתוקנים בגן באמצעות assay שנבחר מתוך PCR בזמן אמת כמותי ו- cytometry זרימה.

בהתגלמויות מסוימות, שיטות הגילוי הנוכחי יכולות לנרמל תגובות נוגדנים ראשוניות ומשניות לחיסון אצל נבדק הזקוק לכך. נורמליזציה של תגובות נוגדנים ראשוניות ומשניות לחיסון יכולה לכלול שחזור של תאי B ו-/או תאי T של ציטוקינים המתפקדים במתג מחלקות ותגובת זיכרון לאנטיגן. ניתן למדוד את התגובה של נוגדנים ראשוניים ומשניים לחיסון באמצעות מבחן חיסון של בקטריופאג. בהתגלמויות מסוימות, ניתן לבחון שחזור תוכניות איתות ציטוקינים מסוג B ו-/או T-cell לאחר חיסון עם חיידק הניאו-אנטיגן התלוי T-X174. בהתגלמויות מסוימות, נורמליזציה של תגובות נוגדנים ראשוניות ומשניות לחיסון יכולה לכלול הגדלת רמת IgA, IgM ו/או IgG בנבדק הזקוק לכך לרמה הדומה לרמת התייחסות הנגזרת מאוכלוסיית ביקורת. בהתגלמויות מסוימות, נורמליזציה של תגובות נוגדנים ראשוניות ומשניות לחיסון יכולה לכלול הגדלת רמת IgA, IgM ו/או IgG בנבדק הזקוק לכך לרמה גדולה מזו של הנבדק הזקוק לכך שלא ניתן טיפול גנטי המתואר כאן. ניתן למדוד את רמת IgA, IgM ו/או IgG באמצעות בדיקת אימונוגלובולין למשל. בהתגלמויות מסוימות, בדיקת האימונוגלובולין כוללת נוגדנים המחייבים IgG, IgA, IgM, שרשרת קפה קלה, שרשרת קלה למבדה ו/או שרשרת כבדה. בהתגלמויות מסוימות, בדיקת האימונוגלובולין כוללת אלקטרופורזה של חלבון בסרום, אימונואלקטרופורזה, אימונודיפוזיה רדיאלית, נפלומטריה וטורבידימטריה. ערכות בדיקת אימונוגלובולינים הקיימות במסחר כוללות MININEPH ™ (אתר קישור, בירמינגהם, בריטניה) ומערכות בדיקת אימונוגלובולין מדקו (דנמרק) ודייד בהרינג (מרבורג, גרמניה). בהתגלמויות מסוימות, דגימה שניתן להשתמש בה למדידת רמות אימונוגלובולין כוללת דגימת דם, דגימת פלזמה, דגימת נוזל מוחי ושדרה ודגימת שתן.

בהתגלמויות מסוימות, שיטות הגילוי הנוכחי יכולות לשפר את הקינטיקה ו/או את המגוון המשובט של שחזור הלימפוציטים בנבדק הזקוק לכך. בהתגלמויות מסוימות, שיפור הקינטיקה של שחזור הלימפוציטים יכול לכלול הגדלת מספר הלימפוציטים מסוג T במחזור לטווח של רמת התייחסות הנגזרת מאוכלוסיית ביקורת. בהתגלמויות מסוימות, שיפור הקינטיקה של שחזור הלימפוציטים יכול לכלול הגדלת מספר הלימפוציטים CD3+ המוחלט לטווח של רמת התייחסות הנגזרת מאוכלוסיית ביקורת. טווח של רמת התייחסות יכול להיות טווח של ערכים הנצפים או מוצגים על ידי נבדקים רגילים (כלומר, שאינם מתפשרים על חיסון) עבור פרמטר נתון. בהתגלמויות מסוימות, שיפור הקינטיקה של שחזור הלימפוציטים יכול לכלול צמצום הזמן הנדרש כדי להגיע לספירות לימפוציטים תקינות בהשוואה לנבדק הזקוק לכך שלא קיבל טיפול המתואר כאן. בהתגלמויות מסוימות, שיפור הקינטיקה של שחזור הלימפוציטים יכול לכלול הגדלת תדירות הלימפוציטים המתוקנים בגן בהשוואה לנבדק הזקוק לכך שלא ניתן לו טיפול המתואר כאן. בהתגלמויות מסוימות, שיפור הקינטיקה של שחזור הלימפוציטים יכול לכלול גידול ברפרטואר המשובט של לימפוציטים מתוקני גנים בנושא בהשוואה לנבדק הזקוק לכך שלא ניתן לו טיפול גנטי המתואר כאן.

בהתגלמויות מסוימות, שיטות הגילוי הנוכחי יכולות לשחזר תגובות חיסוניות בתיווך תאי T אצל אדם הזקוק לכך. שחזור תגובות חיסוניות בתיווך תאי T יכול לכלול שחזור תפוקה תימית ו/או שחזור התפתחות תקינה של לימפוציטים מסוג T.

בהתגלמויות מסוימות, שחזור הפלט התימי יכול לכלול שחזור תדירות תאי CD3+ T המבטאים CD45RA ב- PB לרמה דומה לזו של רמת התייחסות הנגזרת מאוכלוסיית ביקורת. בהתגלמויות מסוימות, שחזור התפוקה התימית יכול לכלול שחזור מספר מעגלי כריתה של קולטן תאי T (TREC) לכל 10 6 תאי T המתבגרים לרמה דומה לזו של רמת התייחסות הנגזרת מאוכלוסיית ביקורת. ניתן לקבוע את מספר TRECs לכל 10 6 תאי T המתבגרים כמתואר בקנדי DR et al. (2011) וטרינר אימונול אימונופתול 142: 36-48.

בהתגלמויות מסוימות, שחזור התפתחות לימפוציטים תקינה של T כולל כולל שחזור היחס בין תאי CD4+: תאי CD8+ ל- 2. בהתגלמויות מסוימות, שחזור התפתחות לימפוציטים תקינה של T כולל איתור נוכחות של αβ TCR במחזוריות לימפוציטים T. ניתן לזהות נוכחות של αβ TCR במחזוריות לימפוציטים מסוג T, למשל, על ידי ציטומטריה של זרימה באמצעות נוגדנים הקושרים שרשרת α ו/או β של TCR. בהתגלמויות מסוימות, שחזור התפתחות תקינה של לימפוציטים T כולל איתור נוכחות של רפרטואר TCR מגוון הדומה לזה של רמת התייחסות הנגזרת מאוכלוסיית ביקורת. ניתן להעריך את גיוון ה- TCR על ידי ספקטראטיפיקציה TCRVβ, המנתחת סידור גנטי של האזור המשתנה של הגן TCRβ. פרופילים חזקים ונורמליים מסוג ספקטרום יכולים להיות מאופיינים בהתפלגות גאוסית של שברים בגודל של 17 משפחות של קטעי TCRVβ. בהתגלמויות מסוימות, שחזור התפתחות לימפוציטים תקינה של T כולל שחזור נתיבי איתות ספציפיים לתאי T. ניתן להעריך שחזור מסלולי איתות ספציפיים לתאי T על ידי ריבוי לימפוציטים בעקבות חשיפה לתאי T המיטוגן פיטוהמגלוטינין (PHA). בהתגלמויות מסוימות, שחזור התפתחות תקינה של לימפוציטים מסוג T כולל שיקום ספירת תאי דם לבנים, ספירת תאים נויטרופילים, ספירת תאים מונוציטים, ספירת תאי לימפוציטים ו/או ספירת תאי טסיות לרמה השווה לרמת התייחסות הנגזרת מאוכלוסיית ביקורת.

בהתגלמויות מסוימות, טיפול יעיל מבחינה טיפולית גורם או מגביר את הייצור של המוגלובין גורם או מגביר את הייצור של בטא-גלובין, או אלפא-גלובין ו/או מגביר את זמינות החמצן לתאים בגוף.

בהתגלמויות מסוימות, טיפול יעיל מבחינה טיפולית מגביר את ספירת תאי הדם, משפר את תפקוד תאי הדם ו/או מגביר חמצון של תאים.

בהתגלמויות מסוימות, טיפול יעיל מבחינה טיפולית מגביר את ייצור הקרישה/גורם קרישה VIII או קרישת/קרישת גורם IX, גורם לייצור גרסאות רגילות של גורם קרישה VIII או גורם קרישה IX, מפחית את ייצור הנוגדנים לקרישת/קרישת גורם VIII או גורם קרישה/קרישה IX, ו/או גורם להיווצרות תקינה של קרישי דם.

בהתגלמויות מסוימות, טיפול יעיל מבחינה טיפולית גורם להתדרדרות המוקופוליסכרידים בליזוזומים, מפחית, מסלק, מונע או מעכב את הנפיחות באיברים שונים, כולל הראש (exp. Macrosephaly), הכבד, הטחול, הלשון או מיתרי הקול מפחיתים. נוזל במוח מפחית את הפרעות במסתמי הלב מונע או מרחיב את צמצום דרכי הנשימה, מפחית או מונע מחלות בדרכי הנשימה העליונות כמו זיהומים ודום נשימה בשינה ו/או מפחית, מסלק, מונע או מעכב את הרס הנוירונים ו/או את התסמינים הקשורים להרס של נוירונים.

בהתגלמויות מסוימות, כמויות יעילות טיפוליות עשויות לספק תפקוד לתאי דם חיסוניים ותאי דם אחרים, להפחית או לחסל מצב בתיווך חיסוני ו/או להפחית או לחסל סימפטום של המצב בתיווך החיסון.

בהתגלמויות מסוימות, שיטות שימוש מסוימות כוללות טיפול במצבים בהם לתאים המתוקנים יש יתרון סלקטיבי על פני תאים שאינם מתוקנים. לדוגמה, ב- FA ו- SCID, לתאים המתוקנים יש יתרון ורק הפיכת הגן הטיפולי לכמה "HSPC" מספיקה ליעילות טיפולית.

שיטות טיפול נוספות ניתן למצוא בבקשת הפטנטים הבינלאומית PCT/US2016/014378, שהוגשה ב- 21 בינואר 2016 ובקשות הזמניות האמריקאיות 62/351,761, שהוגשו ב -17 ביוני 2016 וב- 62/428,994, שהוגשו ב -1 בינואר 2016 , שכל אחת מהן משולבת במפורש כאן במלואן.

(VIII) רמות הפניה הנגזרות מאוכלוסיות הפיקוח. ניתן להשוות בין ערכים שהושגו לפרמטרים הקשורים לטיפול המתואר כאן לרמת ייחוס הנגזרת מאוכלוסיית ביקורת, והשוואה זו יכולה להצביע אם טיפול המתואר כאן יעיל לנבדק הזקוק לכך. ניתן לקבל רמות הפניה ממערך נתונים אחד או יותר רלוונטי מאוכלוסיית ביקורת. "מערך נתונים" כפי שהוא משמש כאן הוא קבוצת ערכים מספריים הנובעים מהערכה של מדגם (או אוכלוסיית דגימות) בתנאי רצוי. ניתן להשיג את ערכי מערך הנתונים, למשל, על ידי השגת אמצעים מדגימה מבניית ובניית מערך נתונים ממדידות אלה. כפי שמובן לאדם המקצועי בתחום, רמת ההתייחסות יכולה להתבסס למשל על כל נוסחה מתמטית או סטטיסטית שימושית וידועה בתחום להגיע לרמת התייחסות מצטברת משמעותית מאוסף של נקודות נתונים בודדות, למשל ממוצע , חציון, חציון ממוצע וכו '. לחלופין, ניתן להשיג רמת התייחסות או מערך נתונים ליצירת רמת התייחסות מספק שירות כגון מעבדה, או ממאגר נתונים או שרת שעליו מאוחסן מערך הנתונים.

ניתן להפיק רמת התייחסות ממערך נתונים ממדדים קודמים הנגזרים מאוכלוסיית ביקורת. "אוכלוסיית ביקורת" היא כל קיבוץ של נבדקים או דגימות בעלות מאפיינים דומים. הקיבוץ יכול להיות על פי, למשל, פרמטרים קליניים, הערכות קליניות, שיטות טיפוליות, מצב מחלה, חומרת המצב וכו 'בהתגלמויות מסוימות, הקיבוץ מבוסס על טווח גילאים (למשל 0-2 שנים) ואי- מעמד בעל פגיעה בחיסון. בהתגלמויות מסוימות, אוכלוסיית ביקורת רגילה כוללת אנשים המתאימים לגיל לנבדק וללא פגיעה בחיסון. בהתגלמויות מסוימות, התאמת הגיל כוללת, למשל, בני 0-6 חודשים 0-1 בני 0-2 שנים 0-3 שנים בגיל 10-15 שנים, כפי שזה רלוונטי מבחינה קלינית בנסיבות העניין. בהתגלמויות מסוימות אוכלוסיית ביקורת יכולה לכלול כאלה שיש להן חסר חיסוני ולא קיבלו כמות יעילה טיפולית

בהתגלמויות מסוימות, רמת ההתייחסות הרלוונטית לערכים של פרמטר מסוים הקשור לטיפול המתואר כאן מתקבלת על סמך הערך של פרמטר מקביל מסוים הקשור לטיפול באוכלוסיית ביקורת כדי לקבוע אם טיפול שנחשף כאן יעיל מבחינה טיפולית. לנושא הזקוק לכך.

בהתגלמויות מסוימות, מסקנות נלקחות על סמך האם ערך מדגם שונה באופן מובהק סטטיסטית או שונה באופן מובהק סטטיסטית מרמת התייחסות. מדד אינו שונה באופן מובהק סטטיסטית אם ההבדל הוא בתוך רמה שניתן לצפות להתרחש על סמך הסיכוי בלבד. לעומת זאת, הבדל או גידול מובהק סטטיסטית הוא כזה שהוא גדול מהצפוי להתרחש במקרה בלבד. ניתן לקבוע את המשמעות הסטטיסטית או היעדרן בכל אחת משיטות שונות המוכרות בתחום. דוגמה למדידה נפוצה של מובהקות סטטיסטית היא ערך p. ערך ה- p מייצג את ההסתברות להשיג תוצאה נתונה המקבילה לנקודת נתונים מסוימת, כאשר נקודת הנתונים היא תוצאה של סיכוי אקראי בלבד. תוצאה נחשבת לרוב למשמעותית (לא במקרה אקראי) בערך p פחות או שווה ל 0.05. בהתגלמויות מסוימות, ערך המדגם "דומה" לרמת ייחוס הנגזרת מאוכלוסיית ביקורת רגילה אם ערך המדגם ורמת הייחוס אינם שונים באופן מובהק סטטיסטית.

(IX) ערכות. הגילוי מספק גם ערכות המכילות כל אחד או יותר מהאלמנטים הנחשפים בשיטות ובהרכבים כאן. בהתגלמויות מסוימות, ערכה יכולה לכלול RNA מנחה וגרעין המסוגל לחתוך רצף יעד בתאי GSH ותבנית HDR. ניתן לספק אלמנטים בנפרד או בשילובים, וניתן לספק אותם בכל מיכל מתאים, כגון בקבוקון, בקבוק, שקית או שפופרת. בחלק מההתגלמויות הערכה כוללת הוראות בשפה אחת או יותר, למשל ביותר משפה אחת.

בהתגלמויות מסוימות, ערכה כוללת ריאגנטים אחד או יותר לשימוש בתהליך תוך ניצול אחד או יותר מהאלמנטים המתוארים כאן. ניתן לספק ריאגנטים בכל מיכל מתאים. לדוגמה, ערכה עשויה לספק מאגר תגובה או אחסון אחד או יותר. ריאגנטים עשויים להיות מסופקים בצורה הניתנת לשימוש במבחן מסוים, או בצורה הדורשת הוספה של רכיב אחד או יותר לפני השימוש (למשל, בתרכיז או בצורת lyophilized). מאגר יכול להיות כל חיץ, כולל אך לא רק מאגר נתרן פחמתי, מאגר נתרן ביקרבונט, מאגר בוראט, מאגר טריס, מאגר MOPS, מאגר HEPES ושילובים שלו. בחלק מההתגלמויות, המאגר הוא בסיסי. בחלק מההתגלמויות, למאגר יש pH מ -7 עד 10. בחלק מההתגלמויות, הערכה כוללת פולינוקלאוטיד תבנית רקומבינציה הומולוגית.

  • 1. שיטה לשינוי גנטי של תא ברצף מטרה בתוך כרומוזום 11 כולל מס 'ID SEQ. 1-194, 197-208, 210, 213, 242, 245, 251, או 254 כולל: יצירת קשר עם התא עם רכיב מיקוד, אלמנט חיתוך ותבנית תיקון מכוונת הומולוגיה שבה ההתקשרות גורמת לחיתוך (i) בתוך רצף היעד ו (ii) תיקון מכוון הומולוגיה (HDR).
  • 2. השיטה של ​​התגלמות 1, שבה רכיב המיקוד, רכיב החיתוך ותבנית התיקון המכוונת להומולוגיה הם חלק ממערכת עריכת גנים של CRISPR, מערכת עריכת גנים מגנונוקלאז, מערכת עריכת גנים של אצבע אבץ (ZFN), או מערכת עריכת גנים מבוססת אפקטור מבוססת אפקטור (TALEN).
  • 3. השיטה של ​​התגלמות 1 או 2, שבה רכיב המיקוד הוא crRNA המכלאה לאחד ממספרי SEQ ID NO. 1-194, 197-208, 210, 213, 242, 245, 251 או 254.
  • 4. השיטה של ​​כל אחת מהתגלמויות 1-3, בה רכיב החיתוך הוא Cpf1 או Cas 9.
  • 5. השיטה של ​​התגלמות 4, שבה ה- Cpf1 או Cas9 כולל רצף שנבחר מתוך מספרי מזהה SEQ: 215-241.
  • 6. השיטה של ​​התגלמות 4, שבה ה- Cpf1 הוא גרסה של Cpf1 שנבחר מתוך מספרי מזהה SEQ: 216-227, או 229-241.
  • 7. השיטה של ​​כל אחת מההתגלמויות 1-6, שבה תבנית התיקון המכוונת להומולוגיה כוללת זרועות הומולוגיה לרצף היעד, ובתבנית התיקון המכוונת להומולוגיה היא חלק מתבנית תורם נוספת הכוללת גן טיפולי המביא לביטוי של מוצר גנטי טיפולי.
  • 8. השיטה של ​​התגלמות 7, שבה הגן הטיפולי או המוצר הגנטי הטיפולי נבחר מתוך חלבון שלד 4.1, גליקופורין, p55, האלל Duffy, גני משפחת גלובין היה פוקס דיסטרופין פירובאט קינאז CLN3 ABCD1 arylsulfatase A SFTPB SFTPC NLX2.1 ABCA3 GATA1 גנים של חלבונים ריבוזומליים TERT TERC DKC1 TINF2 CFTR LRRK2 PARK2 PARK7 PINK1 SNCA PSEN1 PSEN2 APP SOD1 TDP43 FUS ubiquilin 2 C9ORF72, α2β1 αvβ3 αvβ5 αvβ63 BOB/GPR15 CCZ-RX4 CCR-CDR4 7 ICAM ICAM-1 PRR2/HveB HveA α-dystroglycan LDLR/α2MR/LRP PVR PRR1/HveC, קולטן למינין, 101F6, 123F2, 53BP2, abl, ABLI, ADP, aFGF, APC, ApoAI, ApoE, Apo -1, BDNF, Beta*(BLU), bFGF, BLC1, BLC6, BRCA1, BRCA2, CBFA1, CBL, C-CAM, CFTR, CNTF, COX-1, CSFIR, CTS-1, cytosine deaminase, DBCCR-1, DCC, Dp, DPC-4, E1A, E2F, EBRB2, erb, ERBA, ERBB, ETS1, ETS2, ETV6, Fab, FancA, FancB, FancC, FancD1, FancD2, FancE, FancF, FancG, FancI, FancJ, FancL, FancM, FancN, FancO, אוהד cP, FancQ, FancR, FancS, FancT, FancU, FancV ו- FancW, FCC, FGF, FGR, FHIT, fms, FOX, FUS 1, FUS1, FYN, G-CSF, GDAIF, Gene 21, Gene 26, GM- CSF, GMF, gsp, HCR, HIC-1, HRAS, hst, IGF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, ING1, אינטרפרון α, אינטרפרון β, אינטרפרון γ, IRF-1, JUN, KRAS, LCK, LUCA-1, LUCA-2, LYN, MADH4, MADR2, MCC, mda7, MDM2, MEN-I, MEN-II, MLL, MMAC1, MYB, MYC, MYCL1, MYCN, neu, NF-1, NF-2, NGF, NOEY1, NOEY2, NRAS, NT3, NT5, OVCA1, p16, p21, p27, p53, p57, p73, p300, PGS, PIM1, PL6, PML, PTEN, raf, Rap1A, ras, Rb, RB1, RET, rks-3, ScFv, scFV ras, SEM A3, SRC, TALI, TCL3, TFPI, thrombospondin, thymidine kinase, TNF, TP53, trk, T-VEC, VEGF, VHL, WT1, WT-1, YES, zac1, iduronidase, IDS, GNS, HGSNAT, SGSH, NAGLU, GUSB, GALB , GLB1, ARSB, HYAL1, F8, F9, HBB, CYB5R3, γC, JAK3, IL7RA, RAG1, RAG2, DCLRE1C, PRKDC, LIG4, NHEJ1, CD3D, CD3E, CD3Z, CD3G, PTPRC, ZAP70, LCK, , PNP, WHN, CHD7, ORAI1, STIM1, CORO1A, CIITA, RFXANK, RFX5, RFXAP , RMRP, DKC1, TERT, TINF2, DCLRE1B ו- SLC46A1.
  • 9. השיטה של ​​התגלמות 7 או 8, שבה זרועות ההומולוגיה הן 40 נוקלאוטידים (nt) -1000 nt.
  • 10. השיטה של ​​כל אחת מההתגלמויות 1-9, בה רכיב הכוונה ואלמנט החיתוך הן מולקולות נפרדות או חלק ממולקולה דו-תכליתית אחת.
  • 11. השיטה של ​​כל אחת מההתגלמויות 1-10, בה רכיב הכוונה ואלמנט החיתוך מחוברים לחלקיק ננו.
  • 12. השיטה של ​​התגלמות 11, שבה חלקיק הננו כולל חלקיק זהב.
  • 13. השיטה של ​​כל אחת מההתגלמויות 1-12 בה רכיב המיקוד ו/או רכיב החיתוך מצומדים למרווח.
  • 14. השיטה של ​​התגלמות 13 בה המרווח כולל שינוי תיאול.
  • 15. השיטה של ​​התגלמות 14 בה שינוי התאול מקושר באופן קוולנטי אל פני השטח של החלקיק.
  • 16. השיטה של ​​כל אחת מההתגלמויות 13-15 בה רכיב המיקוד כולל קצה 3 ′ וקצה 5 ′, ובו קצה 3 ′ מצומד למרווח.
  • 17. השיטה של ​​כל אחת מההתגלמויות 11-16 בה חלקיק הננו-חלקיק משויך לשתי שכבות לפחות בהן השכבה הראשונה כוללת את אלמנט המיקוד והשכבה השנייה כוללת תבנית תורם הכוללת גן טיפולי ותבניות תיקון מכוונות הומולוגיה ובו לפחות חלק מהשכבה השנייה רחוק יותר מפני השטח של חלקיק הננו מאשר השכבה הראשונה.
  • 18. השיטה של ​​כל אחת מההתגלמויות 11-17, בה חלקיק הננו מחובר למולקולת מיקוד.
  • 19. השיטה של ​​התגלמות 18, שבה מולקולת המיקוד כוללת תחום מחייב CD34 או תחום מחייב CD90.
  • 20.השיטה של ​​כל אחת מההתגלמויות 1-19, שבה התא כולל תא גזע hematopoietic (HSC), תא אב hematopoietic (HPC), גזע hematopoietic ותא אב (HSPC), תא T, רוצח טבעי (NK) תא, תא B, מקרופאג, מונוציט, תא גזע מזנכימלי (MSC), תא דם לבן (WBC), תא חד -גרעיני (MNC), תא אנדותל (EC), תא סטרומה ו/או פיברובלסט של מח עצם.
  • 21. השיטה של ​​התגלמות 20, שבה תא הדם כולל CD34 + CD45RA - CD90 + HSC.
  • 22. השיטה של ​​התגלמות 20 או 21, שבה תא הדם הוא תא דם אנושי.
  • 23. השיטה של ​​כל אחת מההתגלמויות 1-22, בה החיתוך גורם לשבירת גדילים כפולה של ה- DNA עם תלייה של 2-4-nt 5 ′.
  • 24. השיטה בכל אחת מההתגלמויות 1-23 תוך שימוש לפחות באחד מזוגות ה- crRNA של רצף היעדים הבאים: (i) target: SEQ ID NO: 132/crRNA: SEQ ID NO: 195 (ii) target: SEQ ID NO: 108/crRNA: SEQ ID NO: 196 (iii) יעד: SEQ ID NO: 203/crRNA: SEQ ID NO: 209 (iv) יעד: SEQ ID NO: 210/crRNA: SEQ ID NO: 211 (v) יעד: מספר מזהה SEQ: 242/crRNA: SEQ ID NO: 244 ו- (vi) יעד: מזהה SEQ: 251/crRNA: מספר ID SEQ: 253.
  • 25. חלקיק ננו המשויך לשתי שכבות פעילות לפחות, כאשר השכבה הראשונה כוללת אלמנט מיקוד DNA ורכיב חיתוך ובו השכבה השנייה כוללת תבנית תורם הכוללת גן טיפולי ותבניות תיקון המכוונות להומולוגיה ובו לפחות חלקים של השכבה השנייה רחוקה יותר מפני השטח של חלקיק הננו מאשר השכבה הראשונה.
  • 26. חלקיק הננו של התגלמות 24 שבו רכיב המיקוד הכלאה לאחד ממספרי ID SEQ. 1-194, 197-208, 210, 212, 213, 242, 245, 251, 254, 258 או 263.
  • 27. חלקיק הננו של התגלמות 25 או 26, שבו אלמנט המיקוד ל- DNA הוא crRNA עם קצה 3 'וקצה 5', שבו קצה 3 'מוצמד למרווח.
  • 28. חלקיק הננו של כל אחת מההתגלמויות 25-27 בהן רכיב מיקוד ה- DNA הוא crRNA עם קצה 3 ′ וקצה 5 ′, כאשר קצה ה -5 ′ מצומד לרכיב החיתוך.
  • 29. חלקיק הננו של התגלמות 27 או 28 שבו המרווח כולל שינוי תאול המקושר באופן קוולנטי לפני השטח של החלקיק.
  • 30. חלקיק הננו של כל אחת מההתגלמויות 25-29 בהן רכיב החיתוך הוא Cpf1 או Cas 9.
  • 31. חלקיק הננו מכל אחת מההתגלמויות 27-30, שבו ה- crRNA כולל מס 'ID SEQ: 195, 196, 209, 211, 244, 253, 260 או 264.
  • 32. חלקיק הננו של התגלמויות 30 או 31, שבו ה- Cpf1 או Cas9 כולל רצף שנבחר מתוך מספר מזהה SEQ: 215-241.
  • 33. חלקיק הננו של כל אחת מההתגלמויות 30-32, שבו ה- Cpf1 כולל וריאציה של Cpf1 שנבחרה מתוך מספרי מזהה SEQ: 216-227, או 229-241.
  • 34. חלקיק הננו מכל אחד מהתגלמויות 25-33, שבו חלקיק הננו הוא חלקיק זהב.
  • 35. חלקיק הננו של כל אחת מההתגלמויות 25-34, שבו החלקיק הננו מחובר למולקולת מיקוד.
  • 36. חלקיק הננו של התגלמות 35, שבו מולקולת המיקוד כוללת תחום מחייב CD34 או תחום מחייב CD90.
  • 37. ניסוח טיפולי הכולל חלקיק ננו מכל אחת מהתגלמויות 24-35.
  • 38. תא שעבר שינויים גנטיים בשיטה של ​​כל אחת מההתגלמויות 1-24 או חלקיק ננו מכל אחת מההתגלמויות 25-36.
  • 39. התא של התגלמות 38, שבו התא הוא תא גזע hematopoietic (HSC), תא אבות hematopoietic (HPC), גזע hematopoietic ותא אב (HSPC), תא T, תא רוצח טבעי (NK), תא B, מקרופאג, מונוציט, תא גזע מזנכימלי (MSC), תא דם לבן (WBC), תא חד גרעיני (MNC), תא אנדותל (EC), תא סטרומה ו/או מח עצם פיברובלסט.
  • 40. התא של התגלמות 38 או 39, שבו התא הוא CD34 + CD45RA - CD90 + HSC.
  • 41. התא מכל אחת מהתגלמויות 38-40, שבו התא הוא תא דם אנושי.
  • 42. ניסוח טיפולי הכולל תא מכל אחת מההתגלמויות 38-41.
  • 43. שיטה לאספקת רצף חומצות גרעין טיפולי למטופל הזקוק לה כולל מתן ניסוח טיפולי של התגלמות 37 ו/או 42, למטופל ובכך לספק רצף חומצת גרעין טיפולי למטופל.

ניתן להשתמש גם בגרסאות של רצפי חלבון ו/או חומצת גרעין המפורטים כאן. הגרסאות כוללות רצפים עם לפחות 70% זהות רצף, 80% זהות רצף, 85% רצף, 90% זהות רצף, 95% זהות רצף, 96% זהות רצף, 97% זהות רצף, 98% זהות רצף, או 99% זהות רצף. לרצפי החלבון וחומצות הגרעין המתוארים או נחשפים במסמך זה, בהם הגרסה מציגה תפקוד ביולוגי דומה או משופר באופן מהותי.

"זהות רצף%" מתייחסת לקשר בין שני רצפים או יותר, כפי שנקבע על ידי השוואת הרצפים. באמנות, "זהות" פירושה גם מידת הקשר ברצף בין רצפי חלבון וחומצות גרעין כפי שנקבע בהתאמה בין מחרוזות של רצפים כאלה. "זהות" (המכונה לעתים קרובות "דמיון") ניתנת לחישוב בקלות בשיטות ידועות, כולל אלה המתוארות ב: ביולוגיה מולקולרית מולקולרית (Lesk, AM, עורך) Oxford University Press, NY (1988) Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Pressed Academic, NY (1994) ניתוח מחשבים של נתוני רצף, חלק א '(Griffin, AM ו- Griffin, HG, עורכים) Humana Press, NJ (1994) ניתוח רצפים בביולוגיה מולקולרית (Von Heijne, G., עורך) העיתונות האקדמית (1987) ו- Primer Analysis Sequence (Gribskov, M. ו- Devereux, J., עורכים) Oxford University Press, NY (1992). שיטות מועדפות לקביעת זהות נועדו לתת את ההתאמה הטובה ביותר בין הרצפים שנבדקו. שיטות לקביעת זהות ודמיון מקודדות בתוכנות מחשב זמינות לציבור. ניתן לבצע יישור רצפים וחישובי זהות באחוזים באמצעות תוכנית Megalign של חבילת המחשוב הביואינפורמטיקה LASERGENE (DNASTAR, Inc., Madison, Wisc.). ניתן לבצע יישור מרובה של הרצפים גם באמצעות שיטת היישור Clustal (Higgins ו- Sharp CABIOS, 5, 151-153 (1989) עם פרמטרי ברירת מחדל (GAP PENALTY = 10, GAP LENGTH PENALTY = 10). תוכניות רלוונטיות כוללות גם את חבילת התוכניות של GCG (חבילת ויסקונסין גירסה 9.0, קבוצת גנטיקה ממוחשבים (GCG), מדיסון, ויס.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215: 403-410 (1990) DNASTAR ( DNASTAR, Inc, Madison, Wis.) ותוכנית FASTA המשלבת את האלגוריתם של סמית-ווטרמן (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), תאריך פגישה 1992, 111-20. עורך (ים): סוהאי, סנדור. מוציא לאור: מליאה, ניו יורק, ניו יורק במסגרת הגילוי הזה יובן שבמקומות בהם נעשה שימוש בתוכנת ניתוח רצפים לניתוח, תוצאות הניתוח מבוססות על "ערכי ברירת המחדל" של התוכנית שאליה התייחס. "ערכי ברירת מחדל" פירושו כל קבוצת ערכים או פרמטרים, אשר נטענו במקור בתוכנה בעת ההתחלה הראשונה אייז.

בהתגלמויות מסוימות, חלבונים משתנים כוללים החלפות חומצות אמינו שמרניות. בהתגלמויות מסוימות, החלפת חומצות אמינו שמרנית עשויה לא לשנות באופן מהותי את המאפיינים המבניים של רצף ההתייחסות (למשל, חומצת אמינו חלופית אינה צריכה נוטה לשבור סליל המתרחש ברצף ההתייחסות, או לשבש סוגים אחרים של מבנה משני המאפיין רצף ההתייחסות). דוגמאות למבנים משניים ושלישוניים המוכרים על ידי פוליפפטיד מתוארים בחלבונים, מבנים ועקרונות מולקולריים (Creighton, Ed., WH Freeman and Company, New York (1984)) מבוא למבנה חלבונים (C. Branden & J. Tooze, עורכים ., Garland Publishing, ניו יורק, ניו יורק (1991)) ות'ורנטון ואחרים, Nature, 354: 105 (1991).

בהתגלמויות מסוימות, "החלפה שמרנית" כוללת החלפה הנמצאת באחת מקבוצות ההחלפות השמרניות הבאות: קבוצה 1: אלנין (עלא), גליצין (גלי), סרין (סר), תראונין (Thr) קבוצה 2: חומצה אספרטית ( אספ), חומצה גלוטמית (גל) קבוצה 3: אספרגין (אסן), גלוטמין (ג'ין) קבוצה 4: ארגינין (ארג), ליזין (ליס), היסטידין (שלו) קבוצה 5: איזולאוצין (איל), לאוצין (לאו), מתיונין (מט), ואלין (ואל) וקבוצה 6: פנילאלנין (פה), טירוזין (טיר), טריפטופן (טרפ).

בנוסף, ניתן לקבץ חומצות אמינו לקבוצות החלפה שמרניות לפי פונקציה דומה או מבנה כימי או הרכב (למשל חומצי, בסיסי, אליפטי, ארומטי, המכיל גופרית). לדוגמה, קיבוץ אליפטי עשוי לכלול, לצורך החלפה, את Gly, Ala, Val, Leu ו- Ile. קבוצות אחרות המכילות חומצות אמינו הנחשבות כתחליפות שמרניות זו לזו כוללות: גופרית המכילה Met ו- Cysteine ​​(Cys) חומצי: Asp, Glu, Asn ו- Gln שאריות אליפטיות קטנות, לא קוטביות או מעט קוטביות: Ala, Ser, Thr, Pro ו- Gly polar, שאריות טעויות שליליות והאמידים שלהן: Asp, Asn, Glu ו- Gln polar, שאריות טעונות חיוביות: שלו, Arg ו- Lys שאריות אליפטיות גדולות, לא קוטביות: Met, Leu, Ile, Val ו- Cys ו- שאריות ארומטיות גדולות: Phe, Tyr ו- Trp. מידע נוסף נמצא ב- Creighton (1984) Proteins, W.H. פרימן והחברה.

כפי שצוין קודם לכן, בהתגלמויות מסוימות, גרסאות כוללות Cpf1s מהונדסים. לדוגמה, ארה"ב 2018/0030425 מתאר גרעינים מהונדסים של Cpf1 מ חיידק Lachnospiraceae ND2006 ו אסידמינוקוקוס sp. BV3L6 עם סגוליות יעד שונה ומשופרת. וריאנטים מיוחדים כוללים חיידק Lachnospiraceae ND2006 של SEQ ID NO: 232, למשל, לפחות כולל חומצות אמינו 19-1246 של SEQ ID NO: 232, עם מוטציות (כלומר, החלפת חומצת האמינו המקורית בחומצת אמינו שונה, למשל, אלאנין, גליצין או סרין ), באחת או יותר מהעמדות הבאות: S203, N274, N278, K290, K367, K532, K609, K915, Q962, K963, K966, K1002, ו/או S1003 של מזהה מספר מספר: 232 (או בעמדות מקבילות לשם כך, למשל, S185, N256, N260, K272, K349, K514, K591, K897, Q944, K945, K948, K984, ו/או S985 מתוך מספר ID מספר 233). מספר מזהה מספר: 233 זהה למסמך מספר: 232 אך חסרות לו 18 חומצות אמינו ראשונות. גרסאות Cpf1 מסוימות יכולות לכלול גם אסידמינוקוקוס sp. BV3L6 Cpf1 (AsCpf1) של SEQ ID NO: 230, למשל, לפחות הכולל חומצות אמינו 1-1307 של SEQ ID NO: 230, עם מוטציות (כלומר, החלפת חומצת האמינו המקורית בחומצת אמינו שונה, למשל, אלאנין, גליצין או סרין (למעט כאשר חומצת האמינו המקורית היא סרין)), באחת או יותר מהעמדות הבאות: N178, S186, N278, N282, R301, T315, S376, N515, K523, K524, K603, K965, Q1013 , Q1014, ו/או K1054 מתוך מזהה SEQ: 230. בהתגלמויות מסוימות, גרסאות Cpf1 מהונדסות כוללות eCfp1.

גרסאות אחרות של Cpf1 כוללות הומולוגים Cpf1 ואורתולוגים של הפוליפפטידים Cpf1 המתגלים ב- Zetsche et al. (2015) תא 163: 759-771 וכן פוליפפטידים Cpf1 שנחשפו בארה"ב 2016/0208243. דוגמאות לרצפי Cpf1 כוללות מספר מזהה SEQ: 216-227 ו- 229-241 המפורטים כאן.

גרסאות מתוכננות אחרות של Cpf1 ידועות לבעלי מקצוע רגיל בתחום והן נכללות במסגרת הגילוי הנוכחי (ראו למשל WO/2017/184768).

מבנה ייצור מופתי.

דוגמה 1. סינתזה של ליבות ננו -חלקיקי זהב. חלקיקי זהב (AuNPs) בטווח גודל של 15 ננומטר סונתזו בשיטת טורקביץ 'בשינוי קל. טורקביץ 'ואח', (1951). דיונים של חברת פאראדיי 11 (0): 55-75.). 0.25 מ"מ תמיסת חומצה כלוראורית הובאה לנקודת הרתיחה והופחתה על ידי הוספת 3.33% תמיסת נתרן ציטראט ובוחשה במרץ תחת מערכת ריפלוקס למשך 10 דקות. חלקיקים מסונתזים נשטפו שלוש פעמים והופצו מחדש במים טהורים במיוחד.

מבני RNA מדריכי Cpf1 ו- Cas9. RNA מדריך Cpf1 יחיד הוזמן ממקור מסחרי, Integrated DNA Technologies IDT), עם שני שינויים מותאמים אישית בקצה 3 ′. השינוי הראשון כלל מרווח בין 18 אטומים לאוליגו אתילן גליקול (OEG) (iSp18), והשינוי השני כלל שינוי תיאול. מרווח ה- OEG (למשל פוליאתילן גליקול (PEG) או הקסאאתילן גליקול (HEG) וכו ') היה ביחס של 1 לאוליגנוקלאוטיד ושימש למניעת דחייה אלקטרוסטטית בין אוליגנוקלאוטידים. בעוד שנעשה שימוש במרווח של 18 אטומים, גם אורכים אחרים מתאימים. שינוי התאול נוסף גם ביחס של 1 לאוליגונוקלאוטיד ושימש בסיס לאינטראקציות קוולנטיות בכדי לקשור את האוליגנוקלאוטיד לפני השטח של חלקיק הזהב.

הכנת ה- AuNP/CRISPR Nanoformulation. נעשה שימוש ב- crRNAs עם 18 שינויי spacer-thiol. AuNPs בריכוז 10 מיקרוגרם/מ"ל נוספו לפתרון crRNA ביחס AuNP/crRNA w/w של 0.5. לאחר מכן, מאגר ציטראט עם ה- pH של 3 נוסף בריכוז של 10 מ"מ וערבב במשך 5 דקות. Nanoconjugates מוכן AuNP/crRNA הוצמדו למטה ופוזרו מחדש ב- PBS. לאחר מכן, נוקלאז Cpf1 נוספה ביחס AuNP/Cpf1 w/w של 0.6. פוליאתילנימין (PEI) של 2000 מגוואט נוספה בריכוז של 0.005% וערבב היטב. בשלב הסופי, תבנית ssDNA נוספה ביחס AuNP/ssDNA w/w של 1.

דוגמה נבואית 1. הרלוונטיות הטרנסלציונית של מקאק הזנב (מ 'נמטרינה) מודל במונחים של תגובתיות צולבת של ריאגנטים אנושיים וסולם הוקם בעבר. מודל זה שימש שלב חשוב בתרגום קליני של טיפול גנטי ב- HSPC. לדוגמה, מודל זה שימש להערכה ביקורתית של הפוטנציאל ההמטולוגי והבטיחות של הגן LV שהשתנה ו- CCR5 נערך HSPC, ולעקוב אחר גורלם והתמדה של תאים אלה in vivo לאורך שנים. זוגות crRNA אופטימליים המזוהים כמפורט לעיל מזווגים עם אסטרטגיית מסירת ננו -חלקיקים אופטימלית שזוהתה כמפורט לעיל כדי לשנות את HSPC האוטולוגי משלושה פרימטים לא אנושיים להשתלה אוטולוגית לאחר הקרנת גוף מלא. בטיחות והיתכנות מוערכים על ידי מדידת כושר המוצר במבחנה וב in vivo.

בפירוט רב יותר, השתלה אוטולוגית מתבצעת עבור CD34 + CD90 + CD45RA-HSPC לאחר עריכת CRISPR/Cpf1 GSH בתיווך ננו-חלקיקים והכנסת טרנסגן של כתב. שלושה מקקים צמות נעורים מחוללים עם גורם מגרה של מושבה גרנולוציטים אנושית (GCS-F 100 מק"ג/ק"ג/יום × 4 ימים) וגורם תאי גזע (SCF 50 מק"ג/ק"ג/יום × 4 ימים) כזריקות תת עוריות. מח העצם נקטף להפרין ביום ה -4 של תחל. הלוקוציטים מבודדים על ידי תמוגה של אמוניום כלוריד ומתויגים עם נוגדן חד-שבטי IgM 12-8 (CD34 +) ב -4 מעלות צלזיוס למשך 30 דקות, נשטפים ומודגרים עם חרוזי IgM חד-שבביים נגד עכברים למשך 30 דקות ב -4 מעלות צלזיוס ., נשטף ולאחר מכן נבחר בחיסונים. כל הליכי הבחירה הנוספים יתנהלו כמתואר לעיל. ניסוח הפרוטוקול הננו -חלקיקי ופרוטוקול הטיפול המזוהה כמפורט לעיל משמש לביצוע עריכת גנים של GSH והכנסת טרנסגנים ממוקדת GFP. במהלך קופים לשעבר מניפולציה של HSPC מקבלים קרינת גוף טוטאלית (1020cGy) כארבע מנות מפוזרות במשך יומיים ממאיץ לינארי. HSPC שהשתנה על ידי גנים מנוסחים ב- PlasmaLyte ובסרום אוטולוגי לעירוי חוזר תוך ורידי 24 שעות לאחר מתן מינון ההקרנה האחרון. בעלי חיים מקבלים טיפול תומך לפי הצורך (עירויים, נוזלים תוך ורידים וכו ').

מוצרי HSPC שעברו שינוי גנים ייבדקו לכדאיות, יכולת מבנה מושבה חוץ גופית (CFC), עקרות, מיקופלזמה, אנדוטוקסין, פנוטיפ של תאים, היווצרות אינדלים וביטוי טרנסגני. כל פרוטוקולי הבדיקה שיש ליישם מאושרים לשימוש בניסויים קליניים שלב א 'של טיפול בתאים אוטולוגיים. הבטיחות נקבעת על ידי היכולת לייצר תאים שטופלו בננו-חלקיקים אוטולוגיים הנחשבים מתאימים לאינפוזיה (כלומר, סטרילית, נטולת מיקופלזמה, אנדוטוקסין נמוך, ובת קיימא של gt70%). ההיתכנות נקבעת על פי תשואת התא קיימא לאורך כל התהליך והצלחת עריכת GSH והכנסת טרנסגנים כתבים בהיקף. מינון תאי המטרה בחליטה הוא ≥125,000 CD34 + CD90 + CD45RA - תאים לק"ג משקל גוף בהתבסס על הנתונים המקדימים שלנו.

בטיחות in vivo נמדדת לפי קינטיקה של התאוששות המטולוגית וצרכי ​​טיפול תומכים לאחר ההשתלה, כמו גם משובשות של תאים שנערכו בגן שנערך. דם היקפי נאסף מדי יום מכל חיה מושתלת ומנותח על ידי מנתח המטולוגיה אוטומטי עד שנצפית התאוששות המטולוגית. ההתאוששות מוגדרת כמספר נויטרופילים מוחלט & gt500/mcL וטסיות & gt50,000/mcL במשך 3 מדידות רצופות עם מגמה הולכת וגוברת שנצפתה בשני הפרמטרים. לאחר ההתאוששות ההמטולוגית, דם פריפרי נאסף לפחות פעמיים בחודש. Cytometry זרימה מבוצעת באופן קבוע כדי לפקח על רמות engraftment של תאים שטופלו nanoparticle המבטאים transgene הכתב (GFP), כמו גם סמני שושלת כדי לקבוע את היקף של שחזור רב שושלת. DNA גנומי (gDNA) מופק מדגימות אלה ונתון לניתוח על ידי מודד וברקוד DNA ורצף לוקוס GSH כמתואר לעיל. עבור רצף ברקוד DNA, סיבוב יחיד של הגברה PCR מבוצע והתגובות המתקבלות נשלחות לרצף באמצעות פלטפורמת Illumina MiSeq. קריאות רצף כפופות לעיבוד ביואינפורמטי לזיהוי אירועי ברקוד ייחודיים ותרומות שיבוטיות יחסית כמדד לשפע השיבוט. שיבוטים ממופים כפונקציה של זמן ותרומה. עבור רצף לוקוס GSH הפריימרים המתאימים לזוג ה- crRNA האופטימלי המזוהה לעיל משמשים לרצף לוקוס GSH. התדירות של תאים engrafted המכילים indels לעומת קלטות transgene הכתב נקבעת.

מחקר זה קובע את פרוטוקול קנה המידה לעריכת GSH בתיווך ננו-חלקיקים והכנסת גנים כתבת ממוקדת. פרוטוקול זה משמש בסיס להערכת העברת טרנסגנים טיפולית קלינית על פני מטרות מחלות רבות. תוצאות מחקר זה מספקות בסיס להערכה של אסטרטגיות לשיפור ההתרשמות והבידול של HSPC בעריכה גנטית במודל חיות גדול ורלוונטי מבחינה קלינית זו.

דוגמה נבואית 2. לאמת לוקוס GSH אופטימלי לעריכת גנים בתאים CD34 + CD45RA - CD90 +. אספירציות של מח עצם תורם (BM) מתקבלות אצל ספק מסחרי או במסגרת פרוטוקול IRB. מוצרי דם היקפיים (MAPH) מתקבלים מתורמים בריאים לאחר מתן גורם מגרה גרנולוציטים-מושבה (G-CSF) ואיסוף לוקאפרזה. עבור BM, תאי הדם האדומים מדולדלים על ידי שקיעה הטסטרקית, ותאי CD34 + נבחרים בחיסון. עבור mAPH מבוצעת אימונו -בחירה סטנדרטית של תאים CD34 +. התוצרים מועשרים CD34 משני מקורות HSPC מוכתמים בנוגדנים ספציפיים ל- CD90 ו- CD45RA ואוכלוסיית HSPC היעד (CD90 + CD45RA-) נאספת על ידי מיון תאים המופעל הקרינה כמתואר לעיל [Radtke et al., Sci. תרגום. Med. 2017 9 (414).].

תאים CD34+ CD45RA-CD90+ ממוקדים עם מספר גרעיני CRISPR/Cpf1 מרובים המיועדים למועמד GSH שזוהה. הספציפיות והתפקוד מוערכות במבחנה וב in vivo כדי לזהות את מוקד ה- GSH האופטימלי. MRNA מהונדס כימית משמש להגברת היציבות התאית, בעוד שזרועות הומולוגיה ושינוי זרחן משולבות ב- ssODN לשיפור יעילות HDR.

תאים מושעים במדיה של StemSpan המכילים גורמי גדילה רקומביננטיים של תאי גזע (SCF), טרומבופויטין (TPO) וטרוגזין קינאז 3 דמוי fms דמויית ליגנד (flt3-L) ודגירה בטמפרטורה של 30 מעלות צלזיוס למשך 24 שעות. המדיה משתנה למחרת ותרבויות יוכנו לניתוח ועירוי לאחר מכן. הכדאיות מנוטרת על ידי cytometry זרימה ו/או מכתים כחול טריפן.

ניתן ליישם לפחות שלוש שיטות לקביעת היעילות והספציפיות של הוספת הגן. ראשית, ניתן להשתמש בציטומטריה של זרימה להערכת GFP ו/או ביטוי גנים טיפוליים. זה מראה את תדירות התאים עם שילוב קלטות והבעת GFP/ביטוי/פונקציה של הגן. שנית, assay Surveyor (Ran et al. Cell. 2013 154 (6): 1380-1389) משמש לקביעת תדירות האינדלים לעומת הכנסת טרנסגנים בנקודת היעד. בקצרה, תאים מנוגדים ומוחלצים ומטוהרים DNA. ה- DNA המתקבל הוא לכמת ונתון ל- PCR באמצעות פריימרים המיועדים לאזור הממוקד על ידי זוג ה- nuclease הספציפי CRISPR/Cpf1. פקדים מתאימים המכילים חוסר התאמה מוגברים ב- PCR. בעקבות ה- PCR, המוצרים מתערערים ונותחים מחדש ליצירת הטרודופלקסים, אשר מטופלים לאחר מכן באנזים מודד ומנותחים על ידי ג'ל אלקטרופורזה. לאחר מכן משתמשים בהדמיה וצפיפות החישוב לחישוב יעילות העריכה של כל מוקד. לבסוף, BLISS מיושם לזיהוי DSBs מחוץ למטרה (Yan et al. Nat Commun 2017 8: 15058). תאים מועברים תחילה לשקופיות זכוכית על ידי ציטוספין, ואחריו חדירות וקיבוע. DSBs באתרו מלוטשים ומקושרים לאוליגונוקלאוטידים סינתטיים המכילים ברקוד מדגם ייחודי ומזהה מרבב, ואחריו מתאם רצף RA5 Illumina ומקדם T7. לאחר מכן מטוהרים את ה- DNA ונותנים לו סוניק ואחריו שעתוק במבחנה ומוכן כספרייה לרצף מבוסס Illumina. זה מאפשר זיהוי של מיקומים גנומיים של DSBs מחוץ למטרה וכימות של תדר DSB כמספר הקריאות המתאימות למיקום גנומי ספציפי למספר נתון של תאים המנותקים לשקופית המקורית. בעקבות ניתוחים אלה, הצמד האופטימלי של CRISPR/Cpf1 ושילוב ssODN מזוהה לניתוח נוסף in vivo, למשל כמתואר להלן. השילוב האופטימלי מדגים את היעילות הגבוהה ביותר של החדרת טרנסגן ברקוד למקום הרצוי עם רעילות מינימלית במבחנה והתדירות הנמוכה ביותר של היווצרות DSB מחוץ למטרה בין תורמים ומקורות HSPC (BM ו- mAPH).

כפי שיובן לאדם המקצועי בתחום, כל התגלמות המתגלה כאן יכולה לכלול, לכלול בעיקרו את המרכיב, השלב, המרכיב או המרכיב המוצהר שלו. לפיכך, יש לפרש את המונחים "כולל" או "כולל" כך שיאמרו: "מורכב, מורכב או מורכב בעצם." מונח המעבר "מורכב" או "מורכב" פירושו כולל, אך אינו מוגבל, ומאפשר הכללה של אלמנטים, שלבים, מרכיבים או רכיבים לא מוגדרים, אפילו בכמויות גדולות. הביטוי המעבר "המורכב מ" אינו כולל כל אלמנט, שלב, מרכיב או רכיב שלא צוין. ביטוי המעבר "המורכב בעצם" מגביל את היקף ההתגלמות לאלמנטים, השלבים, המרכיבים או המרכיבים שצוינו ולאלו שאינם משפיעים באופן מהותי על ההתגלמות. השפעה מהותית תגרום להפחתה מובהקת סטטיסטית בעריכת הגן באתר GSH ממוקד.

אלא אם כן צוין אחרת, יש להבין את כל המספרים המבטאים כמויות של מרכיבים, תכונות כגון משקל מולקולרי, תנאי תגובה וכן הלאה המשמשים במפרט ובתביעות כפי שהם משתנים בכל המקרים על ידי המונח "בערך". לפיכך, אלא אם כן מצוין ההפך, הפרמטרים המספריים המפורטים במפרט ובתביעות המצורפות הם קירובים שעשויים להשתנות בהתאם למאפיינים הרצויים אותם מבקשים להשיג על ידי ההמצאה הנוכחית. לכל הפחות, ולא כניסיון להגביל את יישום דוקטרינת המקבילות להיקף הטענות, יש לפרש לפחות כל פרמטר מספרי לאור מספר הספרות המשמעותיות המדווחות ועל ידי יישום טכניקות עיגול רגילות. כאשר נדרשת בהירות נוספת, המונח "בערך" הוא בעל משמעות סבירה המיוחסת לו על ידי אדם המיומן בתחום כאשר הוא משמש יחד עם ערך או טווח מספרי מוצהר, כלומר ציון קצת פחות או יותר מהערך או הטווח המוצהר. , עד לטווח של ± 20% מהערך הנקוב ± 19% מהערך הנקוב ± 18% מהערך הנקוב ± 17% מהערך הנקוב ± 16% מהערך הנקוב ± 15% מהערך הנקוב ± 14 % מהערך הנקוב ± 13% מהערך הנקוב ± 12% מהערך הנקוב ± 11% מהערך הנקוב ± 10% מהערך הנקוב ± 9% מהערך הנקוב ± 8% מהערך הנקוב ± 7% מהערך הנקוב ± 6% מהערך הנקוב ± 5% מהערך הנקוב ± 4% מהערך הנקוב ± 3% מהערך הנקוב ± 2% מהערך הנקוב או ± 1% מהערך הנקוב.

למרות שהטווחים והפרמטרים המספריים המציגים את ההיקף הרחב של ההמצאה הם קירובים, הערכים המספריים המופיעים בדוגמאות הספציפיות מדווחים בצורה מדויקת ככל האפשר. אולם כל ערך מספרי מכיל מטבעו שגיאות מסוימות הנובעות בהכרח מסטיית התקן הנמצאת במדידות הבדיקה המתאימות שלהן.

יש לפרש את המונחים "a", "an", "the" ודוגמאות המשמשות בהקשר של תיאור ההמצאה (במיוחד בהקשר של הטענות הבאות) כדי לכסות את היחיד והרבים, אלא אם צוין אחרת כאן או סותר באופן ברור את ההקשר. אמירת טווחי ערכים במסמך זה נועדה אך ורק לשמש כשיטת קיצור של התייחסות בנפרד לכל ערך נפרד הנמצא בטווח. אלא אם כן צוין אחרת כאן, כל ערך בודד משולב במפרט כאילו הוא נאמר בנפרד במסמך זה. כל השיטות המתוארות במסמך זה ניתנות לביצוע בכל סדר מתאים, אלא אם צוין אחרת כאן או סותר באופן ברור את ההקשר. השימוש בכל הדוגמאות, או בשפה למופת (למשל, "כגון") המסופק כאן נועד רק להאיר את ההמצאה ואינו מהווה מגבלה להיקף ההמצאה שנטען אחרת. אין לפרש כל שפה במפרט כמעידה על כל אלמנט שאינו נטען בתביעה החיוני לתרגול ההמצאה.

אין לפרש קיבוצי אלמנטים או התגלמויות של ההמצאה שנחשפו כאן כמגבלות. ניתן להתייחס ולתבוע כל אחד מחברי הקבוצה בנפרד או בכל שילוב עם חברים אחרים בקבוצה או אלמנטים אחרים המופיעים כאן. על פי ההערכות, אחד או יותר מחברי קבוצה עשויים להיכלל בקבוצה או להימחק ממנה מטעמי נוחות ו/או פטנטציות. כאשר מתרחשת כללה או מחיקה כזו, המפרט נחשב כמכיל את הקבוצה כפי שהיא משתנה ובכך ממלא את התיאור הכתוב של כל קבוצות מארקוש המשמשות בתביעות המצורפות.

הגדרות מיוחדות של המצאה זו מתוארות כאן, כולל האופן הטוב ביותר שידוע לממציאים לביצוע ההמצאה. כמובן, וריאציות על התגלמויות המתוארות הללו יתגלו לבעלי המקצוע הרגיל באומנות עם קריאת התיאור לעיל. הממציא מצפה מאומנים מיומנים להשתמש בווריאציות כמתאימות, והממציאים מתכוונים שההמצאה תתקיים אחרת מאשר שתואר במפורש כאן. בהתאם לכך, המצאה זו כוללת את כל השינויים והשקולות של הנושא המפורט בתביעות המצורפות לה כפי שהותר על פי החוק החל. יתר על כן, כל שילוב של האלמנטים המתוארים לעיל בכל הווריאציות האפשריות שלהם מקיף ההמצאה, אלא אם צוין אחרת כאן או סותר באופן ברור את ההקשר.

יתר על כן, הפניות רבות הופנו לפטנטים, פרסומים מודפסים, מאמרים בכתב עת וטקסט כתוב אחר לאורך מפרט זה (חומרים שהוזכרו במסמך זה). כל אחד מהחומרים שהוזכרו משולבים כאן בנפרד בהתייחסות בשלמותם להוראתם.

לסיום, יש להבין כי התגלמויות ההמצאה המתפרסמות כאן ממחישות את עקרונות ההמצאה הנוכחית. שינויים אחרים שניתן להשתמש בהם נמצאים במסגרת ההמצאה. כך, כדוגמה, אך לא בהגבלה, ניתן לנצל תצורות חלופיות של ההמצאה הנוכחית בהתאם לתורות המפורטות כאן. בהתאם לכך, ההמצאה הנוכחית אינה מוגבלת לזה בדיוק כפי שמוצג ומתואר.

הפרטים המוצגים במסמך זה הם כדוגמא ולצורך דיון ממחיש בגירסאות המועדפות על ההמצאה הנוכחית בלבד ומוצגים מתוך הגורם למתן מה שנחשב כתיאור השימושי והקל ביותר להבנת העקרונות וההיבטים הרעיוניים. של התגלמויות שונות של ההמצאה. בהקשר זה, לא נעשה ניסיון להראות פרטים מבניים של ההמצאה בפירוט רב יותר מהנדרש להבנה הבסיסית של ההמצאה, התיאור שצולם עם הציורים ו/או הדוגמאות מראים לאנשים המיומנים בתחום כיצד מספר צורות ההמצאה עשויות להתגלם בפועל.

הגדרות והסברים המשמשים את הגילוי הנוכחי נועדו לשליטה בכל בנייה עתידית, אלא אם כן ישתנו באופן ברור וחד משמעי בדוגמאות הבאות או כאשר יישום המשמעות הופך כל בנייה לחסרת משמעות או בעצם חסרת משמעות. במקרים שבהם בניית המונח תגרום לו להיות חסר משמעות או בעצם חסר משמעות, יש לקחת את ההגדרה ממילון וובסטר, מהדורה שלישית או ממילון המוכר לאנשים בעלי רגיל באמנות, כגון מילון הביוכימיה והביולוגיה המולקולרית של אוקספורד. (עורכים. Attwood T et al., הוצאת אוניברסיטת אוקספורד, אוקספורד, 2006).