מֵידָע

רצף מ- PCR


למיטב הבנתי, ניתן להשתמש ב- PCR ליצירת עותקים רבים של גן אחד. השאלה שלי היא, האם ניתן לרצף DNA לאחר PCR והאם קל יותר מאשר לרצף אותו בשיטות אחרות. אם זה אפשרי, איך היית עושה את זה?


כל שיטות הרצף, בין אם מדובר ברצף קלאסי של סנגר או ברצף הדור הבא (או אפילו בדור השלישי) זקוקים לכמות DNA מסוימת לעבודה.

או שאתה צריך לחלץ DNA מדגימת רקמות גדולות או שאתה צריך להגביר את תכולת ה- DNA מדגימה קטנה יותר. הגישה הראשונה לרוב אינה מעשית, או בלתי אפשרית בעליל (כשרוצים לעבוד עם תאים בודדים או אורגניזמים קטנים מאוד).

אז PCR משמש באופן שגרתי להגברת ה- DNA לפני רצף. הרצף עצמו אינו מושפע מכך - אתה משתמש בכל הטכניקה המתאימה. עם זאת, ה- PCR עשוי להכניס הטיות לנתונים מכיוון שלא כל שברי ה- DNA מתגברים ביעילות שווה. יש לדאוג לכך בניתוח במורד הזרם של נתוני הרצף אם נדרש מידע כמותי (כמו ב- RNA-seq או ChIP-seq).

אם נחזור לשאלתך, PCR אינה שיטת רצף בפני עצמה. זה רק עוזר להשיג את הכמות הדרושה של חומר גלם על מנת שרצף יעבוד. יתר על כן, רוב שיטות הרצף למעשה לִכלוֹל צעדים PCR גם כן, מכיוון שהם מסתמכים על ייצור של שברי DNA חופפים שיש לתפור אותם.


אנחנו עושים את זה כל הזמן. אתה יכול להשתמש באחד מהפריימרים הסופיים/האגפים שלך ולהשתמש בו כפריימר לרצף. לחברות תהיה בדרך כלל מערך שבו תוכל לקחת דוגמה "מעורבת מראש".

מכיוון שאנו נוטים להשתמש ב- sequetech, להלן פרטיהם: http://www.sequetech.com/requirements.php?premixed=1

לקבלת חוות דעת שנייה עיין בכתובת Elimbio: http://www.elimbio.com/Sample_Preparation.htm


דלפק תשובה

כל שיטות הרצף, בין אם מדובר ברצף קלאסי של סנגר או ברצף הדור הבא (או אפילו בדור שלישי) זקוקים לכמות DNA מסוימת לעבודה.

או שאתה צריך לחלץ DNA מדגימת רקמות גדולות או שאתה צריך להגביר את תכולת ה- DNA מדגימה קטנה יותר. הגישה הראשונה לרוב אינה מעשית, או בלתי אפשרית בעליל (כשרוצים לעבוד עם תאים בודדים או אורגניזמים קטנים מאוד).

אז PCR משמש באופן שגרתי להגברת ה- DNA לפני רצף. הרצף עצמו אינו מושפע מכך שאתה משתמש בכל הטכניקה המתאימה. עם זאת, ה- PCR עשוי להכניס הטיות לנתונים מכיוון שלא כל שברי ה- DNA מתגברים ביעילות שווה. יש לדאוג לכך בניתוח במורד הזרם של נתוני הרצף אם נדרש מידע כמותי (כמו ב- RNA-seq או ChIP-seq).

אם נחזור לשאלתך, PCR אינה שיטת רצף בפני עצמה. זה רק עוזר להשיג את הכמות הדרושה של חומר גלם על מנת שרצף יעבוד. יתר על כן, רוב שיטות הרצף למעשה לִכלוֹל צעדים PCR גם כן, מכיוון שהם מסתמכים על ייצור של שברי DNA חופפים שיש לתפור אותם.


שלבים המעורבים בתגובת שרשרת פולימראז ברצף ה- DNA

כמה מהשלבים העיקריים המעורבים בתגובת שרשרת הפולימראז ברצף ה- DNA הם: 1. שלב 1: דנטורציה על ידי חום 2. שלב 2: חישול פריימר לרצף היעד 3. שלב 3: הרחבה 4. שלב 4: סוף מחזור ה- PGR הראשון .

תגובת שרשרת הפולימראז (PGR) מעצימה פיסת DNA אחת במספר סדרי גודל, ראה איור 6.2. זהו יצירת אלפי עד מיליוני עותקים של רצף DNA מסוים.

PGR הוא תהליך או מחזור בן שלושה שלבים. הוא חוזר על עצמו מספר פעמים מוגדר. ברגע שמחזור ה- PGR מורכב משלבים אלה, דהיינו דנטורציה, חישול והרחבה. מכשיר שולט אוטומטית על התהליך שמתרחש במעצב תרמי הטמפרטורות מתחלפות לפרקי זמן מתוכנתים למספר המתאים של מחזורי PGR.

1. שלב 1: דנטורציה על ידי חום:

החום הוא בדרך כלל יותר מ 90 מעלות צלזיוס כאשר מפריד DNA דו-גדילי לשני גדילים בודדים. תהליך זה מכונה “ התבגרות ”. קשרי המימן המקשרים בין הבסיסים זה לזה חלשים, ולכן אפשרית דנטורציה. קשרי המימן נשברים בטמפרטורות גבוהות, בעוד שהקשרים בין דוקסיריבוז לפוספטים נותרים שלמים מכיוון שהם חזקים יותר נשארים שלמים.

2. שלב 2: חישול פריימר לרצף היעד:

המטרה הסופית של PGR היא לשכפל רצף יעד של כ-100-600 זוגות בסיס ייחודיים לאורגניזם הנחקר. מיקוד הרצף מושגת באמצעות פריימרים. פריימרים מסמנים את קצות רצף המטרות.

פריימרים לבדיקת AMPLICOR® הם רצפים סינתטיים קצרים של DNA חד גדילי המורכב בדרך כלל מ- 20-30 בסיסים, עם סיומת 5 ′ המסומנת על ידי ביוטין כדי לסייע באיתור. עבור אזור המטרה של האורגניזם, הם ספציפיים ל- PGR יש שני פריימרים, אחד לכל אחד מחוטי ה- DNA היחידים המשלימים שהופקו במהלך הפחתת קווצות DNA בודדות שהופקו במהלך הדנטורציה.

ההתחלה של רצף היעד העניין של ה- DNA מסומנת על ידי הפריימרים שמחלחלים (נקשרים) לרצף המשלים. החישול מתרחש בדרך כלל בין 40 מעלות צלזיוס ל -65 מעלות צלזיוס, תלוי באורך וברצף הבסיס של הפריימרים.

3. שלב 3: הרחבה:

הטמפרטורה מועלה לכ -72 מעלות צלזיוס לאחר שהפריימרים מחלחלים לרצפי ה- DNA המשלימים. כמו כן, האנזים Taq DNA פולימראז משמש לשכפול של קווצות ה- DNA. Taq DNA פולימראז הוא פולימראז DNA תרמו -רקומביננטי תרמו -יציב מהאורגניזם Thermus aquatics us ובניגוד לאנזימי פולימראז רגילים פעיל בטמפרטורות גבוהות.

תהליך הסינתזה מסנתז מולקולות DNA דו -גדיליות חדשות, שתיהן זהות לאזור ה- DNA היעד המקורי הכפול, על ידי הקלת הקישור וההצטרפות של הנוקלאוטידים המשלימים החופשיים בתמיסה (dNTP). הארכה תמיד מתחילה בקצה 3 ′ של הפריימר, מה שהופך גדיל כפול מכל אחד משני הגדילים הבודדים. Taq DNA פולימראז מסנתז אך ורק בכיוון 5 ′ עד 3 ′.

4. שלב 4: סוף מחזור ה- PGR הראשון:

כעת ישנם שני גדילים חדשים של DNA זהים ליעד המקורי בסוף מחזור ה- PGR הראשון. לגדילים החדשים יש התחלה, המוגדרת במדויק בקצה 5 ′ של הפריימר, אך קצה 3 ′ אינו מוגדר במדויק.

גדיל ה- DNA המסונתז מתבנית כזו יש אז אורך מוגדר במדויק שמוגבל משני קצותיו בקצה 5 ′ של כל אחד משני הפריימרים. קווצות DNA אלה ידועות בשם AMPLIGON. קווצות DNA המתאימות לרצף המטרה. לאחר מספר מחזורים בלבד, קיימים במספרים גדולים בהרבה מרצפי האורך המשתנה. הרצף שלצדו או מוגדר על ידי שני הפריימרים הוא הקטע שמוגבר.


רצף מ- PCR - ביולוגיה

מבוסס PCR נגד ניתוח רצף DNA של רובה ציד

(א) גנום גדול (10 6

7 או יותר bps) נחתך לשברים אקראיים ומשוכפל לספריית וקטורים פלסמיד. מספר רב של פלסמידים אלה מורצפים באופן אקראי, באמצעות פריימר רצף ספציפי לפלסמיד ( סָגוֹל להתפתל). הרצף הגנומי הסופי מתקבל על ידי הרכבת רצפים של שברים חופפים מרובים. בדוגמה זו, מיקום נוקלאוטיד מסוים ( קו אדום ) הוא קונצנזוס של שלושה שיבוטים חופפים (בפועל, ניתן לקרוא כל עמדה נתונה 5

10 פעמים או יותר). מטרת מאמץ הרצף הוא להשיג את הרצף המלא של א יחיד גדול גנום בדיוק רב. קריאה באורך מלא של כל שיבוט נתון אינה חיונית, מכיוון שכיסוי הגנום מיותר ואפשר להוציא אוטומטית אזורים עם דיוק רצף נמוך מהקונצנזוס.

(ב) גנום מיטוכונדריאלי קטן (

1.7 x 10 4 bps) הוא מוגבר PCR כסט של

17 שברים חופפים של 1 kbp. זוגות הפריימר PCR ( אָדוֹם & amp כָּחוֹל מקטעי קו) מתוכננים על סמך הכרת הרצף מאותו מין או קשור. מספר גנומים מנותחים: בדוגמה, 10 אנשים שונים נמצאים ברצף (בפועל, זה עשוי להיות מאות מכל מין אחד). הרצף של כל נוקלאוטיד אחד נקרא בְּדִיוּק פעמיים, מהפריימרים קדימה והגברה לאחור עבור שבר מסוים. מטרת מאמץ הרצף הוא לזהות פולימורפיזם חד-נוקלאוטיד (SNPs) בקרב אנשים רבים ( בלוקים אדומים ). קריאה מדויקת באורך מלא של רצפים ארוכים יותר ( ירוק squiggles) חיוני לזיהוי SNPs מקוריים בתוך אוכלוסיות ממספר מינימלי של שברי PCR. טקסט & אמור איור והעתקה 2000 מאת סטיבן מ. קאר


רצף DNA

הכנת ספריית DNA באיכות גבוהה היא השלב הראשון בניסוי מוצלח של רצף DNA. כאשר מתחילים עם DNA בכמות מוגבלת או באיכות משתנה, שיטת ההכנה של הספרייה חייבת להיות מדויקת ויעילה, תוך הימנעות מצעדים לטיהור המפחיתים את התאוששות המדגם. העמידה בדרישות אלה למגוון רחב של יישומים, תיק רצף ה- DNA שלנו כולל זרימות עבודה של צינורית אחת לדגימות מאתגרות כגון תאים בודדים, DNA ללא תאים או DNA מסוג FFPE.

הכנת ספריית DNA באיכות גבוהה היא השלב הראשון בניסוי מוצלח של רצף DNA. כאשר מתחילים עם DNA בכמות מוגבלת או באיכות משתנה, שיטת ההכנה של הספרייה חייבת להיות מדויקת ויעילה, תוך הימנעות מצעדים לטיהור המפחיתים את התאוששות המדגם. העמידה בדרישות אלה למגוון רחב של יישומים, תיק רצף ה- DNA שלנו כולל זרימות עבודה של צינורית אחת לדגימות מאתגרות כגון תאים בודדים, DNA ללא תאים או DNA מסוג FFPE.

  • ניתן להשתמש בערכת ה- ThruPLEX DNA-Seq בכל יישום DNA-seq, RNA-seq או ChIP-seq ומציע ביצועי רצף חזקים וממוקדים עם כל פלטפורמות העשרת המטרות המובילות.
  • ThruPLEX DNA-Seq HV ו- ThruPLEX Tag-Seq HV מספקים נתונים אמינים ועקביים מדגימות קשות באמצעות זרימת עבודה יעילה ותגים מולקולריים לתיקון שגיאות.
  • ערכת ה- PicoPLEX Single Cell WGA v3 וערכת ה- PicoPLEX Gold Single Cell DNA-Seq הם תקני הזהב לאיתור CNV ואנפואלידיות מתשומות חד-תאיות וברמת פיקוגרמה.

תגובת שרשרת הפולימראז (PCR) מוכרת כאחת הטכנולוגיות המאפשרות ביותר בתחום הביולוגיה המולקולרית. 1 הופעת הדור הבא של רצף (NGS) סללה את הדרך לשלל יישומי PCR חדשים. למעט פרוטוקולים נטולי PCR (שהפכו לתקן הזהב עבור רצף הגנום כולו), רוב האסטרטגיות המשמשות להמרת דגימות לספריות NGS מוכנות לרצף כוללות שלב אחד או יותר של PCR. בנוסף, נעשה שימוש בשיטות מבוססות PCR בשלבים אחרים של תהליך ההכנה לדוגמא, כולל שלבי בקרת איכות ו/או כימות.

NGS מביאה אתגרים רבים לטכנולוגיית ה- PCR. אלה כוללים כמויות מוגבלות של תבנית ואיכות דגימה נמוכה או משתנה. שלבי הגברה של הספרייה דורשים שכפול נכון (ללא משוא פנים) של אוכלוסיות מורכבות ביותר של מולקולות. נאמנות גבוהה במיוחד חיונית להגבלת טעויות PCR העלולות לגרום לשיחות וריאציות גנטיות כוזבות. בין אם אתה יוצר ספריות אמליקון, מגביר או מכמת ספריות מוכנות לרצף, או שאתה משתמש ב- PCR למטרה אחרת בתהליך הכנת הדוגמאות של NGS שלך, יעילות הגברה גבוהה, הטיית הגברה נמוכה ונאמנות גבוהה נחוצים כדי לעבד יותר דוגמאות בהצלחה, לקבל מידע נוסף מכל מדגם ולייעל את משאבי הרצף שלך. פלטפורמת האבולוציה המכוונת המועסקת ב- KAPA אפשרה לנו לפתח את הפולימראזות של הדור הבא שהונדסו במיוחד לעמוד באתגרים אלה.

יישומים מוצגים

Roche Sample Prep Solutions מציעים משפחה של אנזימים המיועדים להגברה חזקה של תבניות מסוגים שונים למגוון רחב של יישומים. אנזימי KAPA אפשרו מדעי חיים ומחקר במשך למעלה מעשור. למידע נוסף על היתרונות של האנזימים שלנו, וכיצד החוקרים משתמשים בהם למטרות שונות בתהליכי עבודה של NGS.


16S rRNA רצף: טכניקה מבוססת PCR לזיהוי מינים חיידקיים

כוכב הלכת הוא בית גידול למיליוני מינים של חיידקים, שלכל אחד מהם יש מאפיינים ספציפיים. זיהוי מינים של חיידקים נמצא בשימוש נרחב באקולוגיה מיקרוביאלית לקביעת המגוון הביולוגי של דגימות סביבתיות ומיקרוביולוגיה רפואית לאבחון חולים נגועים. ניתן לסווג חיידקים באמצעות שיטות מיקרוביולוגיה קונבנציונאליות, כגון מיקרוסקופיה, גידול במדיה ספציפית, בדיקות ביוכימיות וסרולוגיות ומבחני רגישות לאנטיביוטיקה. בעשורים האחרונים שיטות מיקרוביולוגיה מולקולרית חוללו מהפכה בזיהוי החיידקים. שיטה פופולרית היא רצף גנים ריבוזומלי RNA (rRNA) 16S. שיטה זו היא לא רק מהירה ומדויקת יותר משיטות קונבנציונאליות, אלא גם מאפשרת זיהוי זנים שקשה לגדל בתנאי מעבדה. יתר על כן, בידול זנים ברמה המולקולרית מאפשר אפליה בין חיידקים זהים פנוטיפיים (1-4).

16S rRNA מצטרף עם קומפלקס של 19 חלבונים ליצירת יחידת משנה של 30S של הריבוזום החיידקי (5). הוא מקודד על ידי הגן 16R rRNA, הנמצא ושמור מאוד בכל החיידקים בשל תפקידו החיוני בהרכבת הריבוזומים אולם הוא מכיל גם אזורים משתנים שעשויים לשמש טביעות אצבע עבור מינים מסוימים. תכונות אלה הפכו את הגן rSNA 16S לשבר גנטי אידיאלי לשימוש בזיהוי, השוואה וסיווג פילוגנטי של חיידקים (6).

16S רצף הגן rRNA מבוסס על תגובת שרשרת הפולימראז (PCR) (7-8) ואחריה רצף DNA (9). PCR היא שיטת ביולוגיה מולקולרית המשמשת להגברת שברי DNA ספציפיים באמצעות סדרה של מחזורים הכוללים:

i) דנטורציה של תבנית DNA כפולה
ii) חישול של פריימרים (oligonucleotides קצרים) המשלימים את התבנית
iii) הארכת פריימרים על ידי אנזים ה- DNA פולימראז, המסנתז גדיל DNA חדש

סקירה סכמטית של השיטה מוצגת ב איור 1.


איור 1: סקירה סכמטית של תגובת ה- PCR. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

ישנם מספר גורמים החשובים לתגובת PCR מוצלחת, אחד מהם הוא איכות תבנית ה- DNA. ניתן לבצע בידוד של DNA כרומוזומלי מחיידקים באמצעות פרוטוקולים סטנדרטיים או ערכות מסחריות. יש להקפיד במיוחד על קבלת DNA נטול מזהמים העלולים לעכב את תגובת ה- PCR.

אזורים שמורים של הגן rSNA 16S מאפשרים עיצוב של זוגות פריימר אוניברסליים (אחד קדימה ואחד אחורה) שיכולים להיקשר לאזור היעד ולהגדיל אותו בכל מיני חיידקים. אזור היעד יכול להשתנות בגודלו. בעוד שכמה זוגות פריימר יכולים להעצים את רוב הגן rSNA 16S, אחרים מגבירים רק חלקים ממנו. דוגמאות לפריימרים נפוצים מוצגות ב שולחן 1 ואתרי הקישור שלהם מתוארים ב- איור 2.

שם פריימר רצף (5 ' 𔾷 ') קדימה/ אחורה התייחסות
8F ב) AGAGTTTGATCCTGGCTCAG קָדִימָה -1
27F AGAGTTTGATCMTGGCTCAG קָדִימָה -10
515F GTGCCAGCMGCCGCGGTAA קָדִימָה -11
911R GCCCCCGTCAATTCMTTTGA לַהֲפוֹך -12
1391R GACGGGCGGTGTGTRCA לַהֲפוֹך -11
1492R GGTTACCTTGTTACGACTT לַהֲפוֹך -11

שולחן 1: דוגמאות לאוליגנוקלאוטידים סטנדרטיים המשמשים הגברה של גנים rRNA 16S א).
א) ניתן לאמוד את האורך הצפוי של המוצר PCR שנוצר באמצעות שילובי הפריימר השונים על ידי חישוב המרחק בין אתרי הכריכה לפריימר קדימה והפוך (ראה איור 2), לְמָשָׁל גודל המוצר PCR באמצעות זוג פריימר 8F-1492R הוא

1500 bp, ולזוג פריימר 27F-911R

900 bp.
ב) ידוע גם בשם fD1


איור 2: דמות מייצגת של רצף ה- rRNA 16S והאתרים המחייבים פריימר. אזורים שמורים צבועים באפור ואזורים משתנים מלאים בקווים אלכסוניים. כדי לאפשר את הרזולוציה הגבוהה ביותר, פריימר 8F ו- 1492R (שם מבוסס על מיקום על רצף rRNA) משמשים להגברת כל הרצף, מה שמאפשר רצף של מספר אזורים משתנים של הגן. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

תנאי רכיבה על אופניים ל- PCR (כְּלוֹמַר הטמפרטורה והזמן הדרושים לזיהוי ה- DNA, חיטוי בפריימרים ומסונתזים) תלויים בסוג הפולימראז המשמש ובמאפייני הפריימרים. מומלץ לעקוב אחר הנחיות היצרן לגבי פולימראז מסוים.

לאחר השלמת תוכנית ה- PCR, המוצרים נותחו על ידי אלקטרופורזה של ג'ל agarose. PCR מצליח מניב פס אחד בגודל צפוי. יש לטהר את המוצר לפני רצף להסרת פריימרים שאריות, deoxyribonucleotides, פולימראז ומאגר שהיו בתגובת ה- PCR. שברי ה- DNA המטוהרים נשלחים בדרך כלל לרצף לשירותי רצף מסחריים אולם כמה מוסדות מבצעים רצף DNA במתקני הליבה שלהם.

רצף ה- DNA נוצר אוטומטית מכרומטוגרמת DNA על ידי מחשב ויש לבדוק אותו היטב על איכותו, מכיוון שלעתים יש צורך בעריכה ידנית. בעקבות שלב זה, רצף הגנים מושווה לרצפים המופקדים במאגר הנתונים של rSNA 16S. אזורי הדמיון מזוהים, והרצפים הדומים ביותר מועברים.

תהליך

  1. בעת הטיפול במיקרואורגניזמים, יש צורך לעקוב אחר שיטות מיקרוביולוגיות טובות. יש להתייחס לכל המיקרואורגניזמים, במיוחד דגימות לא ידועות, כאל פתוגנים פוטנציאליים. בצע טכניקה אספטית כדי להימנע מזיהום הדגימות, החוקרים או המעבדה. שטפו ידיים לפני ואחרי טיפול בחיידקים, השתמשו בכפפות ולבשו ביגוד מגן.
  2. בצע הערכת סיכון לפרוטוקול הניסיוני לבידוד ה- DNA הגנומי וטיהור המוצר PCR. ריאגנטים מסוימים עלולים להזיק!
  3. תרבות טהורה חיונית לרצף ה- rRNA 16S. לפני שתתחיל בבידוד של ה- DNA הגנומי, ודא שחומר המוצא הוא טהור לחלוטין. ניתן לעשות זאת על ידי ציפוי פס לבידוד מושבות בודדות. ניתן לגדל את אלה מפוספסים על צלחות בנפרד, או במרק, במידת הצורך.
  4. ציוד מעבדה נדרש:
    1. מחזור תרמי ל- PCR. תפקידו של המחזור התרמי הוא להעלות ולהוריד את הטמפרטורה על פי תוכנית מוגדרת. בעת יצירת התוכנית תתבקשו להזין את ערכי הטמפרטורה והזמן עבור כל שלב PCR וכן את מספר המחזורים הכולל.
    2. מערכת אלקטרופורזה של ג'ל אגרוזה. הוא משמש להפרדת שברי DNA בהתאם לגודלם ולמטען. בפרוטוקול זה, אלקטרופורזה של ג'ל agarose תשמש לדמיין את האיכות של DNA גנומי מבודד ומוצרי PCR.

    הערה: הפרוטוקול שהודגם חל על רצף גנים של rSNA 16S מתרבית חיידקים טהורה. זה לא חל על מחקרים metagenomic.

    1. גידול חיידקים לבידוד ה- DNA הגנומי (gDNA).
      1. הגדל את המיקרואורגניזם שלך על מדיום מתאים. ניתן להשתמש במדיה נוזלית ומוצקה בשלב זה. בחר תנאים שמניבים את הצמיחה הטובה ביותר. בעת תכנון הניסוי, זכור כי חיידקים הגדלים לאט עשויים להידרש מספר ימים כדי להגיע לשלב הצמיחה המאוחר/נייח. בפרוטוקול זה, Bacillus subtilis 168 גדל במרק ליזוגני (LB) בן לילה בחממה רועדת שנקבעה על 200 סל"ד, 37 °C.
      1. אם גדלו חיידקים על מדיום מוצק, גירדו כמה תאים בעזרת לולאה סטרילית והפיצו אותם מחדש ב -1 מ"ל מים מזוקקים.
      2. אם חיידקים גדלו במדיום נוזלי, השתמש בכ -1.5 מ"ל של תרבות לילה.
      3. גלול את התאים על ידי צנטריפוגה (דקה אחת, 12,000 - 16,000 × גרם), הסר את תגובת שיקוע והשתמש בתאים לבידוד gDNA באמצעות ערכה מסחרית או פרוטוקולים סטנדרטיים [לְמָשָׁל הכנת ה- DNA הכוללת של CTAB (13) או מיצוי פנול-כלורופורם (14)]. כאן, ערכה מסחרית שימשה לבודד gDNA מ -1.5 מ"ל ב. Subtilis 168 תרבות לילה, OD600 = 1.5.
        הערה 1: עבור חלק מהחיידקים הגראם שליליים ניתן להשמיט שלב זה ולהחליפו על ידי שחרור פשוט של DNA מהתאים על ידי הרתחה. Resuspend גלולה חיידקית במים מזוקקים דגירה בתוך בלוק חימום שנקבע על 100 °C למשך 10 דקות.
        פתק 2: קשה לשבש תאים חיידקיים חיוביים לגראם. לכן מומלץ לבחור בשיטת בידוד או ערכה של gDNA המוקדשת לבידוד מקבוצת חיידקים זו.
      1. בדוק את האיכות של ה- gDNA המבודד על ידי אלקטרופורזה של ג'ל agarose. ראשית, מערבבים 5 µL של ה- gDNA המבודד עם 1 µL של צבע הטעינה (6x), וטוענים את הדגימה על ג'ל agarose 0.8% המכיל מגיב מכתים DNA.
      2. טען תקן מסה מולקולרית והפעל את האלקטרופורזה עד שחזית הצבע מגיעה לתחתית הג'ל.
      3. לאחר שהאלקטרופורזה הושלמה, דמיינו את הג'ל על מנורה מתאימה (או UV או אור כחול). gDNA מופיע כרצועה מולקולרית גבוהה עבה (מעל 10 קילוגרם). דוגמה לבדיקת איכות gDNA מוצגת ב איור 3.
      4. אם ה- gDNA עובר את בקרת האיכות (כְּלוֹמַר. הלהקה המולקולרית הגבוהה קיימת ואין מעט מריחה של ה- gDNA), דלל את ה- gDNA שלך באופן סדרתי על ידי תיוג ראשון של 3 צינורות מיקרוצנטריפוגות כדלקמן: ൒x ", 蔴x " ו- 񓐈x " .
      5. פיפטה 90 µL של מים מזוקקים סטריליים לכל אחת משלוש הצינורות.
      6. קח 10 µL של הפתרון gDNA והוסף אותו לצינור המסומן ൒x ".
      7. פיפט את כל הנפח (כְּלוֹמַר 100 µL) למעלה ולמטה ביסודיות כדי לוודא שהתמיסה מעורבת באופן אחיד. לאחר מכן, קח 10 µL של הפתרון מצינור זה והעבר אותו לצינור המסומן 蔴x ".
      8. מערבבים כפי שתואר קודם וחזור על אותו הליך על ידי העברת 10 µL של הפתרון מהצינור 蔴x " לצינור 񓐈x ". דילולים אלה ישמשו כתבנית בתגובת ה- PCR.


      איור 3: אלקטרופורזה של ג'ל אגרוזה של gDNA מבודדת Bacillus subtilis. מסלול 1: מ - סמן מסה מולקולרית (מלמעלה למטה: 10000 bp, 8000 bp, 6000 bp, 5000 bp, 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp). מסלול 2: gDNA - DNA גנומי מבודד מ Bacillus subtilis. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

      1. הגברה של הגן rSNA 16S על ידי PCR.
        הערה: פרוטוקול ה- PCR להלן מותאם עבור פולימראז DNA וזוג פריימר מסוים 8F - 1492R (ראה טבלה 1). אופטימיזציה של הפרוטוקול נדרשת עבור כל זוג פולימראז ופריימר.
        1. להפשיר את כל הריאגנטים על קרח.
        2. הכן את תערובת האב PCR כפי שמוצג בטבלה 2. מכיוון שהפולימראז ה- DNA פעיל בטמפרטורת החדר, יש לבצע את הגדרת התגובה על קרח, כְּלוֹמַר את הצינורות PCR ואת רכיבי התגובה יש לשמור על קרח כל הזמן. הכן תגובה אחת לכל דגימת gDNA ותגובה אחת לשליטה שלילית. שליטה שלילית היא תערובת PCR ללא תבנית gDNA ומשמשת להבטחת רכיבי התגובה האחרים שלא יזוהו.
          הערה: במקרה של דגימות מרובות, בדרך כלל מכינים תערובת אב. תערובת מאסטר היא פתרון המכיל את כל רכיבי התגובה למעט התבנית. זה עוזר להשמיט פיפטות חוזרות ונשנות, להימנע משגיאת פיפטה ומבטיח עקביות גבוהה בין הדגימות. כדי להכין תערובת אב, הכפל את נפח כל רכיב (למעט תבנית ה- DNA) במספר הדגימות שנבדקו. מערבבים את כל הרכיבים בצינור המיקרוצנטריפוגות ומכניסים את כל הנפח למעלה ולמטה מספר פעמים.
        3. Aliquot 49 µL של תערובת המאסטר לתוך צינורות ה- PCR האישיים.
        4. הוסף תבנית 1 µL לצינורות עם תערובת אב. לבקרה שלילית הוסיפו 1 µL מים סטריליים. כדי לוודא שהמרכיבים מעורבבים היטב, העבירו את התערובת בעדינות למעלה ולמטה

        שולחן 2: רכיבי תגובת PCR. * השתמש ב- 10x, 100x או 1000x gDNA מדולל משלב 2.3.

        שלב טֶמפֶּרָטוּרָה זְמַן מחזורים
        דנטורציה ראשונית 98 °C 30 שניות
        דנטורציה 98 °C 10 שניות 25-30
        רִכּוּך 60 °C 30 שניות
        סיומת 72 °C 45 שניות
        הארכה אחרונה 72 °C 7 דקות
        לְהַחזִיק 4 °C

        שולחן 3: תוכנית PCR להגברה של הגן rSNA 16S.


        איור 4: אלקטרופורזה של ג'ל אגרוזה של מוצרי PCR מוגברת באמצעות פריימרים 8F ו- 1492R ו- gDNA כתבנית. מדגם gDNA מ ב. Subtilis (ראה איור 3) מדולל 10, 100 ו -1000 פעמים על מנת לבדוק את התוצאה הטובה ביותר. מסלול 1: מ - סמן מסה מולקולרית (מלמעלה למטה: 10000 bp, 8000 bp, 6000 bp, 5000 bp, 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000bp, 750 bp, 500 bp, 250 bp ). מסלול 2: תגובת PCR עם תבנית מדוללת פי 10. מסלול 3: תגובת PCR עם תבנית מדוללת פי 100. מסלול 4: תגובת PCR עם תבנית מדוללת פי 1000. מסלול 5: (C-) - שליטה שלילית (תגובה ללא תבנית ה- DNA). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

        3. ניתוח נתונים ותוצאות

        הערה: המוצר PCR הוא ברצף באמצעות הפריימרים קדימה (כאן 8F) וההפוך (כאן 1492R). לכן, שתי קבוצות של רצף נתונים נוצרות, אחת לפנים קדימה ואחת לפריימר הפוך. לכל רצף נוצרים לפחות שני סוגי קבצים: i) קובץ טקסט המכיל את רצף ה- DNA ו- ii) כרומטוגרמת DNA, המציגה את איכות ריצת הרצף.

        1. לפריימר קדימה, פתח את הכרומטוגרמה ובדוק היטב את הרצף. כרומטוגרמה אידיאלית לרצף איכותי צריכה להיות בעלת פסגות מרווחות באופן שווה ואותות רקע מועטים או לא (איור 5א).
        2. אם הכרומטוגרמה אינה איכותית, יש למחוק את הרצף או לשנות את קובץ הטקסט של הרצף בהתאם להוראות הבאות:
          1. הנוכחות של פסגות כפולות לאורך הכרומטוגרמה מצביעה על נוכחותן של מספר תבניות DNA. זה יכול להיות המצב אם תרבות החיידקים לא הייתה טהורה. יש להשליך רצף כזה (איור 5ב).
          2. כרומטוגרמה דו -משמעית עשויה לנבוע מנוכחותם של פסגות בצבעים שונים באותו מיקום. אחת השגיאות הנפוצות ביותר היא הימצאותן של שתי פסגות בצבעים שונים באותו מיקום והקצאה לא נכונה של הבסיסים על ידי תוכנת הרצף (איור 5ג). תקן באופן ידני כל נוקלאוטידים שהוקצו לא נכון וערוך אותם בקובץ הטקסט.
          3. כרומטוגרמות ברזולוציה נמוכה יכולות לגרום ל#34 פסגות רחבות ו#34 שגורמות לעתים קרובות לספירה לא נכונה של הנוקלאוטידים באזורים אלה (איור 5ד). קשה לתקן שגיאה זו, ולכן אין להתייחס לאמינות אפשרית בשלב היישור הנוסף כאמינות.
          4. איכות קריאת כרומטוגרמה ירודה והימצאות של פסגות מרובות נראות בדרך כלל בקצות 5 ' ו- 3 ' של הרצף. חלק מתוכנות הרצף מסירות את השברים באיכות נמוכה אלה באופן אוטומטי (איור 5ה), והנוקליאוטידים אינם כלולים בקובץ הטקסט. אם הרצף שלך לא נקטע באופן אוטומטי, קבע את השברים באיכות נמוכה (לְמָשָׁל אות חלש, פסגות חופפות, אובדן רזולוציה) בקצוות והסר את הבסיסים המתאימים מקובץ הטקסט.


          איור 5: דוגמאות לפתרון בעיות ברצף DNA. א) דוגמה לרצף כרומטוגרמה איכותי (פסגות בעלות מרווח שווה וחד משמעי). ב) רצף באיכות ירודה המתרחש בדרך כלל בתחילת הכרומטוגרמה. אזור האפור האפור נחשב לאיכות נמוכה ומוסר אוטומטית על ידי תוכנת הרצף. ניתן לחתוך יותר בסיסים באופן ידני. ג) נוכחות של פסגות כפולות (מסומנות בחצים). נוקלאוטיד המסומן בחץ האדום נקרא על ידי הרצף כ- "T " (פסגה אדומה), אך השיא הכחול חזק יותר, וניתן לפרש אותו גם כ-#34C ". ד) פסגות חופפות מצביעות על זיהום DNA (כְּלוֹמַר יותר מתבנית אחת). ה) אובדן רזולוציה ומה שנקרא " פסגות רחבות " (מסומן במלבן) המונעות קריאת בסיס מהימנה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

          1. חזור על 3.1 ו- 3.2 עבור הפריימר ההפוך.
          2. לבסוף, הרכיבו את הרצפים קדימה ואחורה לרצף אחד רציף. ריצת רצף טובה מניבה רצף של עד 1100 bp. בהתחשב במוצר ה- PCR

          1. למזג את שני הרצפים באמצעות תוכנית הרכבת רצף ה- DNA, לְמָשָׁל כלי חינמי כגון CAP3 (http://doua.prabi.fr/software/cap3) (15).
          2. הכנס את שני הרצפים בפורמט FASTA לתיבה המצוינת. לחץ על הלחצן " שלח " והמתן עד שהתוצאות יחזרו.
          3. כדי לצפות ברצף המורכב לחץ על "Contigs " בכרטיסיית התוצאות. לצפייה בפרטי היישור לחץ על " פרטי הרכבה ".
            הערה 1: אם תוכנת CAP3 משמשת להרכבת קונטיג אין צורך להמיר את רצף הפריימר ההפוך להשלמה הפוכה, אולם ייתכן שיהיה צורך בשלב זה אם נעשה שימוש בתוכנית אחרת.
            פתק 2: פורמט FASTA הוא פורמט מבוסס טקסט המייצג את רצף הנוקלאוטידים. השורה הראשונה (שורת התיאור) בקובץ FASTA מתחילה בסמל " > " ואחריו השם או מזהה ייחודי של הרצף. בעקבות שורת התיאור נמצא רצף הנוקלאוטידים. הדבק את הרצפים שלך בפורמט הבא:

          1. בחר בכלי "Nucleotide BLAST " כדי להשוות את הרצף שלך למסד הנתונים.
          2. הזן את הרצף שלך (הקונטג 'המורכב ב -3.5) בתיבת הטקסט "Query Query ", ולאחר מכן בחר את מסד הנתונים ൘S rRNA (Bacteria and Archea) " בתפריט הגלילה למטה.
          3. לחץ על הלחצן "BLAST " בתחתית הדף. הרצפים הדומים ביותר יוחזרו. תוצאת BLAST לדוגמה מוצגת ב- איור 6. בניסוי המוצג הלהיט העליון הוא ב. Subtilis זן 168, המראה 100% זהות עם הרצף הזמין במסד הנתונים של BLAST.
          4. אם הלהיט העליון אינו מראה זהות של 100%, עבור אל היישור ובדוק אם אין התאמות. בלחיצה על הלהיט העליון, תועבר לפרטי היישור. לנוקלאוטידים המיושרים יצטרפו קווים אנכיים קצרים בעוד שלנוקלאוטידים שאינם תואמים יש פער ביניהם. חזור לכרטומטוגרמה שקיבלת מחברת הרצף ושנה את הרצף שוב תוך התמקדות באזור הלא תואם. תקן את הרצף אם נמצאו שגיאות נוספות. הפעל שוב את BLAST באמצעות הרצף המתוקן.


          איור 6: דוגמה לתוצאת ה- BLAST של הנוקלאוטיד. 16S רצף גנים rRNA מתרבות טהורה של ב. Subtilis 168 שימש כרצף שאילתה. הלהיט העליון מראה 100% זהות (מסומנת בקו תחתון) ל- ב. Subtilis זן 168, כצפוי. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

          כדור הארץ הוא ביתם של מיליוני מינים של חיידקים, שלכל אחד מהם מאפיינים ייחודיים. זיהוי מינים אלה הוא קריטי בהערכת דגימות סביבתיות. הרופאים גם צריכים להבחין בין מינים חיידקיים שונים כדי לאבחן חולים נגועים.

          כדי לזהות חיידקים, ניתן להשתמש במגוון טכניקות, כולל תצפית מיקרוסקופית של מורפולוגיה או צמיחה במדיה ספציפית להתבוננות במורפולוגיה של המושבה. ניתוח גנטי, טכניקה נוספת לזיהוי חיידקים גדלה בפופולריות בשנים האחרונות, בין היתר בשל רצף גנים RNA ריבוזומלי של 16S.

          הריבוזום החיידקי הוא מכלול RNA חלבון המורכב משתי יחידות משנה. יחידת המשנה 30S, הקטנה מבין שתי יחידות המשנה האלה, מכילה 16S rRNA, המקודדת על ידי הגן 16S rRNA הכלול בתוך ה- DNA הגנומי. אזורים ספציפיים של 16S rRNA שמורים מאוד, בשל תפקידם החיוני בהרכבת הריבוזומים. בעוד אזורים אחרים, פחות קריטיים לתפקוד, עשויים להשתנות בין מיני חיידקים. האזורים המשתנים ב- rSNA 16S, יכולים לשמש טביעות אצבע מולקולריות ייחודיות למיני חיידקים, ומאפשרים לנו להבחין בין זנים זהים פנוטיפיים.

          לאחר קבלת דגימה איכותית של gDNA, PCR של הגן המקודד rSNA 16S יכול להתחיל. PCR היא שיטת ביולוגיה מולקולרית נפוצה, המורכבת ממחזורים של דנטורציה של תבנית ה- DNA הדו-גדילית, חישול של זוגות פריימר אוניברסליים, המגבירים אזורים גנים שמורים מאוד והרחבת פריימרים על ידי פולימראז DNA. בעוד שחלק מהפריימרים מעצימים את רוב הגן המקודד ל- 16S rRNA, אחרים מגבירים רק שברים ממנו. לאחר PCR, ניתן לנתח את המוצרים באמצעות אלקטרופורזה של ג'ל agarose. אם ההגברה הצליחה, הג'ל צריך להכיל להקה אחת בגודל צפוי, בהתאם לזוג הפריימר המשמש, עד 1500bp, האורך המשוער של הגן rSNA 16S.

          לאחר טיהור ורצף, לאחר מכן ניתן להזין את הרצפים שהתקבלו במאגר הנתונים של BLAST, שם ניתן להשוות אותם לרצפי 16R rRNA הפניה. As this database returns matches based on the highest similarity, this allows confirmation of the identity of the bacteria of interest. In this video, you will observe 16S rRNA gene sequencing, including PCR, DNA sequence analysis and editing, sequence assembly and database searching.

          When handling microorganisms, it is essential to follow good microbiological practice, including using aseptic technique and wearing appropriate personal protective equipment. After performing an appropriate risk assessment for the microorganism or environmental sample of interest, obtain a test culture. In this example, a pure culture of Bacillus subtilis משמש.

          To begin, grow your microorganism on a suitable medium in the appropriate conditions. In this example, Bacillus subtilis 168 is grown in LB broth overnight in a shaking incubator set to 200 rpm at 37 degrees Celsius. Next, use a commercially available kit to isolate genomic DNA or gDNA from 1.5 milliliters of the B. subtilis overnight culture.

          To check the quality of the isolated DNA, first mix five microliters of the isolated gDNA with one microliter of DNA gel loading dye. Then, load the sample onto a 0.8% agarose gel, containing DNA staining reagent, such as SYBR safe or EtBr. After this, load a one kilobase molecular mass standard onto the gel, and run the electrophoresis until the front dye is approximately 0.5 centimeters from the bottom of the gel. Once the gel electrophoresis is complete, visualize the gel on a blue light transilluminator. The gDNA should appear as a thick band, above 10 kilobase in size and have minimal smearing.

          After this, to create serial dilutions of the gDNA, label three microcentrifuge tubes as 10X, 100X, and 1000X. Then, use a pipette to dispense 90 microliters of sterile distilled water into each of the tubes. Next, add 10 microliters of the gDNA solution to the 10X tube. Pipette the whole volume up and down to ensure the solution is mixed thoroughly. Then, remove 10 microliters of the solution from the 10X tube and transfer this to the 100X tube. Mix the solution as previously described. Finally, transfer 10 microliters of the solution in the 100X tube, to the 1000X tube.

          To begin the PCR protocol, thaw the necessary reagents on ice. Then, prepare the PCR master mix. Since the DNA polymerase is active at room temperature, the reaction set up must occur on ice. Aliquot 49 microliters of the master mix into each of the PCR tubes. Then, add one microliter of template to each of the experimental tubes and one microliter of sterile water to the negative control tube, pipetting up and down to mix. After this, set the PCR machine according to the program described in the table. Place the tubes into the thermocycler and start the program.

          Once the program is complete, examine the quality of your product via agarose gel electrophoresis, as previously demonstrated. A successful reaction using the described protocol should yield a single band of approximately 1.5 kilobase. In this example, the sample containing 100X diluted gDNA yielded the highest quality product. Next, purify the best PCR product, in this case, the 100X gDNA, with a commercially available kit. Now the PCR product can be sent for sequencing.

          In this example, the PCR product is sequenced using forward and reverse primers. Thus, two data sets, each containing a DNA sequence and a DNA chromatogram, are generated: one for the forward primer and the other for the reverse primer. First, examine the chromatograms generated from each primer. An ideal chromatogram should have evenly spaced peaks with little to no background signals.

          If the chromatograms display double peaks, multiple DNA templates may have been present in the PCR products and the sequence should be discarded. If the chromatograms contained peaks of different colors in the same location, the sequencing software likely miscalled nucleotides. This error can be manually identified and corrected in the text file. The presence of broad peaks in the chromatogram indicates a loss of resolution, which causes miscounting of the nucleotides in the associated regions. This error is difficult to correct and mismatches in any of the subsequent steps should be treated as unreliable. Poor chromatogram reading quality, indicated by the presence of multiple peaks, usually occurs at the five prime and three prime ends of the sequence. Some sequencing programs remove these low quality sections automatically. If your sequence was not truncated automatically, identify the low quality fragments and remove their respective bases from the text file.

          Use a DNA assembly program to assemble the two primer sequences into one continuous sequence. Remember, sequences obtained using forward and reverse primers should partially overlap. In the DNA assembly program, insert the two sequences in FASTA format into the appropriate box. Then, click the submit button and wait for the program to return the results.

          To view the assembled sequence, click on Contigs in the results tab. Then, to view the details of the alignment, select assembly details. Navigate to the website for the basic local alignment search tool, or BLAST, and select the nucleotide BLAST tool to compare your sequence to the database. Enter your sequence into the query sequence text box and select the appropriate database in the scroll down menu. Finally, click the BLAST button on the bottom of the page, and wait for the tool to return the most similar sequences from the database.

          In this example, the top hit is B. subtilis strain 168, showing 100% identity with the sequence in the BLAST database. If the top hit does not show 100% identity to your expected species or strain, click on the sequence which most closely matches your query to see the details of the alignment. Aligned nucleotides will be joined by short vertical lines and mismatched nucleotides will have gaps between them. Focusing on the identified mismatched regions, revise the sequence and repeat the BLAST search if desired.

          נדרש מנוי. אנא המלץ על JoVE לספרנית שלך.

          יישומים וסיכום

          Identifying bacterial species is important for different researchers, as well as for those in healthcare. 16S rRNA sequencing was initially used by researchers to determine phylogenetic relationships between bacteria. In time, it has been implemented in metagenomic studies to determine biodiversity of environmental samples and in clinical laboratories as a method to identify potential pathogens. It enables a quick and accurate identification of bacteria present in clinical samples, facilitating earlier diagnosis and faster treatment of patients.

          נדרש מנוי. אנא המלץ על JoVE לספרנית שלך.

          הפניות

          1. Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane D.J. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol.173 (2): 697-703. (1991)
          2. Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.P., Raoult D. 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J Clin Microbiol.38 (10):3623-3630. (2000)
          3. Woo, P.C., Lau, S.K., Teng, J.L., Tse, H., Yuen, K.Y. Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories. Clin Microbiol Infect.14 (10):908-934. (2008)
          4. Tang, Y.W., Ellis, N.M., Hopkins, M.K., Smith, D.H., Dodge, D.E., Persing, D.H. Comparison of phenotypic and genotypic techniques for identification of unusual aerobic pathogenic gram-negative bacilli. J Clin Microbiol.36 (12):3674-3679. (1998)
          5. Tsiboli, P., Herfurth, E., Choli, T. Purification and characterization of the 30S ribosomal proteins from the bacterium Thermus thermophilus. Eur J Biochem.226 (1):169-177. (1994)
          6. Woese, C.R. Bacterial evolution. Microbiol Rev.51 (2):221-271. (1987)
          7. Bartlett, J.M., Stirling, D. A short history of the polymerase chain reaction. Methods Mol Biol.226:3-6. (2003)
          8. Wilson, K.H., Blitchington, R.B., Greene, R.C. Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. J Clin Microbiol.28 (9):1942-1946. (1990)
          9. Shendure, J., Balasubramanian, S., Church, G.M., Gilbert, W., Rogers, J., Schloss, J.A., Waterston, R.H. (2017) DNA sequencing at 40: past, present and future. טֶבַע.550:345-353.
          10. Lane, D.J. 16S/23S rRNA sequencing. (1991) In Nucleic acid techniques in bacterial systematics. (Goodfellow, M. and Stackebrandt, E., eds.) p.115-175. Wiley and Sons, Chichester, United Kingdom.
          11. Turner, S., Pryer, K.M., Miao, V.P., Palmer, J.D. (1999) Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J Eukaryot Microbiol.46:327-338.
          12. Fredricks, D.N., Relman, D.A. (1998) Improved amplification of microbial DNA from blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J Clin Microbiol.36:2810-2816.
          13. Wilson, K. Preparation of genomic DNA from bacteria. (2001) Curr Protoc Mol Biol. Chapter 2:Unit 2.4.
          14. Wright, M. H., Adelskov, J., Greene, A.C. (2017) Bacterial DNA extraction using individual enzymes and phenol/chloroform separation. J Microbiol Biol Educ.18:18.2.48.
          15. Huang, X., Madan, A. (1999). CAP3: A DNA sequence assembly program. הגנום Res.9:868-877.

          תמלול

          Earth is home to millions of bacterial species, each with unique characteristics. Identifying these species is critical in evaluating environmental samples. Doctors also need to distinguish different bacterial species to diagnose infected patients.

          To identify bacteria, a variety of techniques can be employed, including microscopic observation of morphology or growth on a specific media to observe colony morphology. Genetic analysis, another technique for identifying bacteria has grown in popularity in recent years, due in part to 16S ribosomal RNA gene sequencing.

          The bacterial ribosome is a protein RNA complex consisting of two subunits. The 30S subunit, the smaller of these two subunits, contains 16S rRNA, which is encoded by the 16S rRNA gene contained within the genomic DNA. Specific regions of 16S rRNA are highly conserved, due to their essential function in ribosome assembly. While other regions, less critical to function, may vary among bacterial species. The variable regions in 16S rRNA, can serve as unique molecular fingerprints for bacterial species, allowing us to distinguish phenotypically identical strains.

          After obtaining a quality sample of gDNA, PCR of the 16S rRNA encoding gene can begin. PCR is a commonly used molecular biology method, consisting of cycles of denaturation of the double-stranded DNA template, annealing of universal primer pairs, which amplify highly conserved regions of the gene, and the extension of primers by DNA polymerase. While some primers amplify most of the 16S rRNA encoding gene, others only amplify fragments of it. After PCR, the products can be analyzed via agarose gel electrophoresis. If amplification was successful, the gel should contain a single band of an expected size, depending upon the primer pair used, up to 1500bp, the approximate length of the 16S rRNA gene.

          After purification and sequencing, the obtained sequences can then be entered into the BLAST database, where they can be compared with reference 16S rRNA sequences. As this database returns matches based on the highest similarity, this allows confirmation of the identity of the bacteria of interest. In this video, you will observe 16S rRNA gene sequencing, including PCR, DNA sequence analysis and editing, sequence assembly and database searching.

          When handling microorganisms, it is essential to follow good microbiological practice, including using aseptic technique and wearing appropriate personal protective equipment. After performing an appropriate risk assessment for the microorganism or environmental sample of interest, obtain a test culture. In this example, a pure culture of Bacillus subtilis is used.

          To begin, grow your microorganism on a suitable medium in the appropriate conditions. In this example, Bacillus subtilis 168 is grown in LB broth overnight in a shaking incubator set to 200 rpm at 37 degrees Celsius. Next, use a commercially available kit to isolate genomic DNA or gDNA from 1.5 milliliters of the B. subtilis overnight culture.

          To check the quality of the isolated DNA, first mix five microliters of the isolated gDNA with one microliter of DNA gel loading dye. Then, load the sample onto a 0.8% agarose gel, containing DNA staining reagent, such as SYBR safe or EtBr. After this, load a one kilobase molecular mass standard onto the gel, and run the electrophoresis until the front dye is approximately 0.5 centimeters from the bottom of the gel. Once the gel electrophoresis is complete, visualize the gel on a blue light transilluminator. The gDNA should appear as a thick band, above 10 kilobase in size and have minimal smearing.

          After this, to create serial dilutions of the gDNA, label three microcentrifuge tubes as 10X, 100X, and 1000X. Then, use a pipette to dispense 90 microliters of sterile distilled water into each of the tubes. Next, add 10 microliters of the gDNA solution to the 10X tube. Pipette the whole volume up and down to ensure the solution is mixed thoroughly. Then, remove 10 microliters of the solution from the 10X tube and transfer this to the 100X tube. Mix the solution as previously described. Finally, transfer 10 microliters of the solution in the 100X tube, to the 1000X tube.

          To begin the PCR protocol, thaw the necessary reagents on ice. Then, prepare the PCR master mix. Since the DNA polymerase is active at room temperature, the reaction set up must occur on ice. Aliquot 49 microliters of the master mix into each of the PCR tubes. Then, add one microliter of template to each of the experimental tubes and one microliter of sterile water to the negative control tube, pipetting up and down to mix. After this, set the PCR machine according to the program described in the table. Place the tubes into the thermocycler and start the program.

          Once the program is complete, examine the quality of your product via agarose gel electrophoresis, as previously demonstrated. A successful reaction using the described protocol should yield a single band of approximately 1.5 kilobase. In this example, the sample containing 100X diluted gDNA yielded the highest quality product. Next, purify the best PCR product, in this case, the 100X gDNA, with a commercially available kit. Now the PCR product can be sent for sequencing.

          In this example, the PCR product is sequenced using forward and reverse primers. Thus, two data sets, each containing a DNA sequence and a DNA chromatogram, are generated: one for the forward primer and the other for the reverse primer. First, examine the chromatograms generated from each primer. An ideal chromatogram should have evenly spaced peaks with little to no background signals.

          If the chromatograms display double peaks, multiple DNA templates may have been present in the PCR products and the sequence should be discarded. If the chromatograms contained peaks of different colors in the same location, the sequencing software likely miscalled nucleotides. This error can be manually identified and corrected in the text file. The presence of broad peaks in the chromatogram indicates a loss of resolution, which causes miscounting of the nucleotides in the associated regions. This error is difficult to correct and mismatches in any of the subsequent steps should be treated as unreliable. Poor chromatogram reading quality, indicated by the presence of multiple peaks, usually occurs at the five prime and three prime ends of the sequence. Some sequencing programs remove these low quality sections automatically. If your sequence was not truncated automatically, identify the low quality fragments and remove their respective bases from the text file.

          Use a DNA assembly program to assemble the two primer sequences into one continuous sequence. Remember, sequences obtained using forward and reverse primers should partially overlap. In the DNA assembly program, insert the two sequences in FASTA format into the appropriate box. Then, click the submit button and wait for the program to return the results.

          To view the assembled sequence, click on Contigs in the results tab. Then, to view the details of the alignment, select assembly details. Navigate to the website for the basic local alignment search tool, or BLAST, and select the nucleotide BLAST tool to compare your sequence to the database. Enter your sequence into the query sequence text box and select the appropriate database in the scroll down menu. Finally, click the BLAST button on the bottom of the page, and wait for the tool to return the most similar sequences from the database.

          In this example, the top hit is B. subtilis strain 168, showing 100% identity with the sequence in the BLAST database. If the top hit does not show 100% identity to your expected species or strain, click on the sequence which most closely matches your query to see the details of the alignment. Aligned nucleotides will be joined by short vertical lines and mismatched nucleotides will have gaps between them. Focusing on the identified mismatched regions, revise the sequence and repeat the BLAST search if desired.


          Sequencing and Genomic Technologies

          The Sequencing and Genomic Technologies Core Facility has purchased an Oxford Nanopore GridION sequencer and will start offering Oxford Nanopore sequencing services in the coming months.

          January 8, 2021

          The Sequencing and Genomic Technologies Core now offers single-cell multi-omics assays on the Tapestri Platform. This innovative platform analyzes genotype and phenotype simultaneously from the same single cells, which lets you reveal clonal heterogeneity and target comprehensive biomarkers.

          November 16, 2020

          COVID-19: The COVID-19 pandemic is generating various supply chain issues for lab consumables, such as tips, 96-well plates and more recently, Illumina sequencing reagents (NovaSeq S-Prime flow cells, in particular). As a consequence, the turnaround time for some of our sequencing services may be impacted. We are doing our best to secure necessary supplies, and we thank you for your patience during these difficult times.

          Reminder, the lab is located at
          Duke Center for Genomic and Computational Biology
          אוניברסיטת דיוק
          Chesterfield Bldg.
          701 W. Main Street
          Suite 320
          Durham NC 27701

          Next-Generation Sequencing Solutions
          Illumina, PacBio, NGS Library preparation including single-cell RNA-seq

          The Sequencing and Genomic Technologies Shared Resource is a basic research oriented core facility affiliated with the Duke Cancer Institute (DCI). This Shared Resource has a track record more than a decade-long of providing constantly updated, state-of-the-art genomic services. The Sequencing and Genomic Technologies Shared Resource offers the full range of genomic technologies, making it much simpler for researchers to find the right service for their needs.

          Director Nicolas Devos is available for face-to-face project consultations on campus in the CIEMAS building or at our new facility.

          PUBLICATION ACKNOWLEDGEMENT

          For all publications that include data generated in the Sequencing and Genomic Technologies Shared Resource, we kindly request that you acknowledge this support:

          We thank the Duke University School of Medicine for the use of the Sequencing and Genomic Technologies Shared Resource, which provided _________ service.


          What are PCR Primers?

          Polymerase Chain Reaction (PCR) is a genetic technique that is utilized in the field of molecular biology in order to amplify a single or few copies of a particular DNA segment and to obtain many millions of identical copies. In a PCR reaction, different components are used including primers. Primers are short DNA strands with a nucleotide length of 18-25 making them compatible with the start and the end region of the DNA fragments to be amplified. Primers can be a forward primer and reverse primer. These primers bind to the DNA fragment at the specific points where it makes DNA polymerase to bind to the specific primer at the location and initiate the synthesis of the new DNA strand.

          The selection of primers is an important aspect of PCR process. The selection of the length of the primer is important. The ideal length would be 18-25 nucleotides. If the length is too short or too long, the primers will not bind to the DNA sequence to be amplified accurately. Primers that are too short in length leads to non-specific primer annealing at different locations of the DNA sequence.

          Figure 01: PCR Primers

          The Guanine and Cytosine (GC) content in a good primer should be in the range of 40-60. The primer annealing temperature and melting temperature are vital factors during PCR. The melting temperature should be calculated accurately, and the primer annealing temperature should be 5 0 C less than the melting temperature. The melting temperature should be 60 °C and 75 °C. Too high or too low temperatures will result in less active DNA polymerase activity.


          What is the PCR process?

          Step 1: Denaturation

          As in DNA replication, the two strands in the DNA double helix need to be separated.

          The separation happens by raising the temperature of the mixture, causing the hydrogen bonds between the complementary DNA strands to break. This process is called denaturation.

          Step 2: Annealing

          Primers bind to the target DNA sequences and initiate polymerisation. This can only occur once the temperature of the solution has been lowered. One primer binds to each strand.

          Step 3: Extension

          New strands of DNA are made using the original strands as templates. A DNA polymerase enzyme joins free DNA nucleotides together. This enzyme is often Taq polymerase, an enzyme originally isolated from a thermophilic bacteria called Thermus aquaticus. The order in which the free nucleotides are added is determined by the sequence of nucleotides in the original (template) DNA strand.

          The result of one cycle of PCR is two double-stranded sequences of target DNA, each containing one newly made strand and one original strand.

          The cycle is repeated many times (usually 20–30) as most processes using PCR need large quantities of DNA. It only takes 2–3 hours to get a billion or so copies.

          PCR technology is still developing. There is continuing development and refinement of the processes and tools used, allowing the process to be adapted to meet specialist needs. For instance, new methods and refinements are being developed and used, especially when quantification of DNA in a sample is needed. New methods include real-time PCR or quantitative PCR (qPCR) and digital PCR (dPCR). In qPCR, the amplification of DNA is monitored in real time, allowing the quantification of target DNA throughout the process. dPCR is a new, more refined approach that breaks the PCR process up into many smaller steps. It offers increased precision, more reliable measurements and absolute quantification from very small or mixed samples.


          צפו בסרטון: כיצד עובד הDNA? (יָנוּאָר 2022).