מֵידָע

כיצד myosins לגרום קיצור myofibrils?


אני יודע שחיבור והטיה של מיוזינים לאקטינים הם הגורמים לקיצור הסרקומר. אבל אני קצת מבולבל לגבי הפרטים. המבנה של סרקומר עשוי מרצועות חלופיות של נימי אקטין ומיוזין. אז כאשר האקטין נמשך מקוצר על ידי חוטי המיוזין משני צידיו, האם הוא לא יחווה כוחות לכיוונים שונים? אם כן, מדוע ניתן לקצר את הסרקומר ולא לקרוע אותו? אני קצת מבולבל לגבי האופן שבו תנועת המוסין גורמת בדיוק להתכווצות השריר.


מיקרוסקופיה שנפתרה על ידי קיטוב חושפת מנגנון בלתי תלוי מוטורי של שריר המוסיקה של הזמנת אקטין מולקולרית במהלך התבגרות סרקומר

מכון השותפות לנוירוביולוגיה ואשכול הצטיינות בתאים בתנועה (EXC 1003-CiM), אוניברסיטת מינסטר, מינסטר, גרמניה, המחלקה לזואולוגיה, אוניברסיטת קולומביה הבריטית, ונקובר, קנדה

תפקידים אוצר נתונים, חקירה, מתודולוגיה

שיוך מכון מקס פלאנק לביוכימיה, קבוצת Muscle Dynamics, Martinsried, גרמניה

תפקידים רכישת מימון, פיקוח

מכון ההתאחדות לנוירוביולוגיה ואשכול הצטיינות בתאים בתנועה (EXC 1003-CiM), אוניברסיטת מינסטר, מינסטר, גרמניה

תפקידים מושגים, רכישת מימון, מתודולוגיה, פיקוח, כתיבה - טיוטה מקורית, כתיבה - סקירה ועריכה

שיוך Aix Marseille Université, CNRS, Centrale Marseille, Institut Fresnel, Marseille, צרפת

תפקידים המשגה, רכישת מימון, פיקוח, כתיבה - טיוטה מקורית, כתיבה - סקירה ועריכה

שיוך Aix Marseille Université, CNRS, IBDM, מרסיי, צרפת

תפקידים המשגה, ניתוח פורמלי, רכישת מימון, פיקוח, ויזואליזציה, כתיבה - טיוטה מקורית, כתיבה - סקירה ועריכה

שותפות Aix Marseille Université, CNRS, IBDM, מרסיי, צרפת, מכון מקס פלאנק לביוכימיה, קבוצת Muscle Dynamics, Martinsried, גרמניה


תַקצִיר

שריר השלד מורכב מחבילות של מיופייבר המכילים מיליוני מיופיברילים, שכל אחד מהם בנוי ממבני סרקומר מיושרים לאורך. סרקומרים הם יחידת ההתכווצות המינימלית, המורכבת בעיקר מארבעה מרכיבים: להקות Z, נימים דקים, נימים עבים וקונטין/טיטין. הגודל והצורה של רכיב הסרקומר נשלטים בקפדנות. באופן מפתיע, תאי שריר השלד לא רק מסנתזים סדרה של חלבונים myofibrillar אלא גם מווסתים את הרכבה של חלבונים אלה למבני הסרקומר. עם זאת, לא ניתן לבנות מחדש מבני סרקומר אותנטיים על ידי שילוב חלבונים מיופייבריליים מטוהרים במבחנה, לכן חייב להיות מנגנון משוכלל המבטיח את היווצרותו הנכונה של מבנה המופיפיריל בתאי שריר השלד. סקירה זו דנה בתפקידו של מיוזין, מרכיב עיקרי של נימה עבה, ביצירת נימים עבים ובדינמיקה של מיוזין בתאי שריר השלד. שינויים במספר myofibrils ב- myofibers יכולים לגרום להיפרטרופיה או ניוון שרירים. לכן, חשוב להבין את המנגנונים הבסיסיים שבאמצעותם myofibers שולטים ביצירת myofibril ברמה המולקולרית כדי לפתח גישות המשפרות ביעילות את צמיחת השרירים בבעלי חיים.


פיזיולוגיה של השרירים ומצב ה- myosin SRX

Myosin RLC מסדיר את מצב SRX myosin

ידוע זה מכבר כי זרחון – דפוספורילציה של RLC פועל כמתג בינארי "מופעל" - "כבוי" להפעלת פעילות מיוזין של שריר חלק (נסקרו ב- Trivedi et al., 2018). קיימת נטייה חזקה של מיוזין של שריר חלק לא מאוזן להתקפל למצב IHM. מיוזינים של שרירים מפוספסים אינם מופעלים 'מופעלים' ו'כבים 'בצורה זו. עם זאת, ידוע כי זרחון RLC מכוון את תפקוד המיוזין המפוספס בכמה דרכים שונות (Yu et al., 2016). מחקרים מוקדמים הראו כי זרחון משפיע על סידור ראשי המיוזין בחוטים של שרירי השלד (Levine et al., 1996). יש גם עדויות לויסות ויסות של זרחון RLC במודלים שונים של אי ספיקת לב ולבבות קרדיומיופתיה מורחבת (Huang et al., 2008 van der Velden et al., 2003 Toepfer et al., 2013). ברמה המולקולרית, ממצאים מרובים הובילו להשערה שבמצב הנינוח של סרקומר השריר המפוספס, כאשר תת-אוכלוסייה של RLCs אינה זרחנית, חלק מראשי מיוזין מוחזקים על עמוד השדרה שבה המיוזין נחשב למצב IHM (נבדק על ידי קרייג וודהד, 2006 ו- Alamo et al., 2018). הזרחון של ה- RLCs גורם לאחר מכן למיוזינים הללו להיות קשורים באופן רופף יותר עם עמוד השדרה של נימה המאפשרים אינטראקציות חוצות גשרים עם אקטין (נסקרו ב- McNamara et al., 2015 ו- Trivedi et al., 2018), מה שמציע כוונון עדין של הפונקציונלי מצב 'ו'כבוי' של מיוזין. מה זה אומר מבחינת שיווי המשקל של מצב myosin DRX↔SRX? המחקר הראשון שדיווח על יכולתה של זרחון RLC להפחית את מצב SRX של מיוזין היה בסיבי שרירי שלד ארנב (סטיוארט ואח ', 2010) ולאחר מכן הופץ בשרירי השלד של הטרטולה (Naber et al., 2011). תצפית דומה נעשתה כאשר גרסה פוספומימטית של ה- RLC, S15D, ברקע מוטציה R58Q RLC הגורם ל- HCM, הפחיתה את מצב SRX בסיבי שריר פפילרי חזירי (Yadav et al., 2019). דו"ח זה נדון בהמשך בסעיף 'מצב חולה ומאפננים טיפוליים של מצב myosin SRX'. בחוטים עבים מיוסין לבביים מחודשים באורך מלא, דווח לאחרונה גם כי זרחון של ה- RLC עם MLCK או דלדול RLC מקטין את אוכלוסיית המיוזין במדינת SRX (Gollapudi et al., 2020a). כל התצפיות הללו יחד מרמזות על שינוי ב- RLC זרחון בתיווך שיווי המשקל של מצב DRX↔SRX כלפי מצב DRX של מיוזין. שינוי זה כלפי מצב DRX תואם עם הפחתת האוכלוסייה של מצב ה- IHM המבני עם זרחון RLC (Alamo et al., 2016). התצפית כי גורמים המשפיעים על ה- RLC משפיעים גם על אוכלוסיית מדינת ה- SRX אינה מפתיעה אם מניחים שמצב IHM הוא מקור מרכזי למצב SRX, שכן שני ה- RLC נקשרים זה לזה ויוצרים את אחד הממשקים העיקריים המתייצבים. מצב IHM (Alamo et al., 2016).

שרשרת אור חיונית של מיוזין עשויה להיות חיונית למצב SRX של myosin

תפקידה של שרשרת אור חיונית (ELC) וכיצד התקשרות Ca 2+ ל- ELC (בתחום הרגולציה של הקרקפת המכילה שתי שרשראות קלות יחד עם קטע קצר של השרשרת הכבדה) מסדירה את התכווצות השרירים הרכיכותית הייתה מוקד המחקר במעבדות של אנדרו Szent-Gyorgyi ואחרים (Szent-Györgyi, 1975 Fromherz ו- Szent-Györgyi, 1995 Chantler, 2006 Trybus, 1994). הוכח כי קישור 2+ ל- ELC מפעיל את האוזימט והבנייה את המיוזין ממצבו "כבוי" דמוי IHM (Woodhead et al., 2013). עם זאת, תפקידו של ELC בשריר הלב, השלד או החלקה אינו מובן היטב. מספר מעבדות הראו כי הרחבה ספציפית של N-terminal של ה- ELC עשויה למלא תפקיד חיוני בוויסות התפקוד המוטורי של המיוזין וייצור הכוח בשרירים מפוספסים (Kazmierczak et al., 2009 Muthu et al., 2011 Guhathakurta et al., 2015) . לאחרונה, ההשערה כי תחום N-Terminal זה של ELC הלב פועל כמתג מקשר מולקולרי של האינטראקציה אקטין-מיוזין על ידי ויסות שיווי המשקל של מצב DRX↔SRX נבדק בשריר הפפילרי של עכברים המהונדסים להביע ELC חסר N שלו -43 חומצות אמינו סופיות (Tg-Δ43). העדר מסוף ה- N של ה- ELC בעכברים הביא לגידול משמעותי באוכלוסיית המיוזין במצב SRX, ומכאן שהפחית את שיעור ראשי המיוזין הזמינים לאינטראקציה עם אקטין (Sitbon et al., 2020). בהסכמה, מיוזין מטוהר מלב Tg-Δ43 הראה ירידה משמעותית בניצול ATP ו- ATPase מיוזין המופעל על ידי אקטין נמוך בהשוואה ללבבות מסוג WT. למרות שהמחקרים מוגבלים, תצפית זו מניחה את תפקידה של ELC בוויסות מצב myosin SRX ודורשת מחקרים נוספים בעתיד כדי לגבש את ההשערה. בסך הכל נראה כי שתי שרשראות הקלות הקשורות למיוזינים מפוספסים ממלאות תפקיד מכריע בשליטה על אוכלוסיית המיוזין במצב SRX, ובכך מתפקדות כמעברים רגולטוריים של התכווצות השרירים.

גיל, מין והסדרה הורמונלית של מצב myosin SRX

בשרירי השלד הרפויים, הוערך כי

50% מהמיוזינים נשארים במצב SRX, והשאר במצב DRX (Stewart et al., 2010 Cooke, 2011). ידוע גם כי ללא קשר לגודל השריר או לנוכחות מחלות נוירולוגיות או שריריות, יש אובדן הדרגתי של כוח השריר עם ההזדקנות, המכונה dynapenia. פגיעה כזו הקשורה לגיל בהתכווצות שרירי השלד בולטת יותר בקרב נשים לאחר גיל המעבר מאשר אצל גברים באותה קבוצת גיל. לכן, חשוב להבין אם הזדקנות ומין יכולים לשנות את שיווי המשקל של מצב myosin DRX↔SRX או לשנות את המאפיינים של מצב SRX. השערה זו נבדקה בשריר ה- psoas של צעירים (בני 3-4 חודשים) ומבוגרים (בני 26-28 חודשים) C57BL/6 עכברים ונקבות, וללא השפעות משמעותיות על אוכלוסיית ה- SRX כפונקציה של גיל או מין ( Phung et al., 2018) נצפו. עם זאת, רק עבור עכברים נקבות, זמן רכיבת ATPase של מיוזין הן במצבי DRX והן ב- SRX היה מהיר יותר באופן משמעותי עם הגיל. ידוע כי הורמון השחלות אסטרדיול הוא האות ההורמונלי המרכזי לשרירי השלד אצל נקבות, ומחסורו פוגע במיוזין ובתפקוד השרירים. במחקר קודם (Colson et al., 2015) של אותה מעבדה, ניסויי מחזור בודדים בעכברי C57BL/6 השחלות גילו שתי אוכלוסיות שונות של מיוזין במצבי SRX ו- DRX בשיעור דומה לאוכלוסיות שנראו בבקרה. עכברים. עם זאת, שיעור מחזור ATP של אוכלוסיית ה- SRX עלה באופן משמעותי בהשוואה לבקרות הלא-ניתוחיות. השפעה זו הוחזרה לשליטה ב- WT על ידי טיפול כרוני של 60 יום בעכברי כריתת השחלות עם אסטרדיול, אך לא על ידי טיפול בשריר ה- psoas המבודד עם אסטרדיול, מה שמרמז כי איתות בתיווך אסטרדיול מסדיר באופן הפיך את מחזור ה- ATP האיטי על ידי מיוזין. בסך הכל, כותבי מחקרים אלה טוענים כי הזדקנות הנקבות, מה שמוביל לדלדול ההורמון אסטרדיול, מעביר את מיוזין השריר יותר לכיוון מצב דמוי DRX עם רכיבה מהירה יותר על אופני ATP. המחברים משערים כי הדבר עלול לגרום להצטברות של מתחמי אקטומיוזין כרוכים חלש, ואולי להתחרות עם הקיימים המחויבים חזק, ובכך להוביל להאטת קינטיקה חוצה גשרים ולהגדלת חולשה עם הגיל. אפשרות חלופית יכולה להיות שהמעבר לעבר יותר ראשי DRX עשוי לפצות על אובדן סיבי שריר ולא הגורם לאובדן התכווצות. מחקרים אלה עשויים לרמוז על ההבדלים המולקולריים בתכונות השרירים בין המינים וקבוצות הגיל, וחקרים רבים נוספים בכיוון זה יידרשו כדי להוכיח את אחת ההשערות.

תפקיד הסידן בוויסות מצב SRX מיוזין

Ca 2+ ממלא תפקיד משמעותי במגוון תהליכים ביולוגיים בגוף. תהליך כזה שנחקר היטב הוא הפעלה של התכווצות שרירי השלד והלב המתווכת על ידי קישור ישיר של Ca 2+ למכלול נימה הדק המווסת על ידי אקטין-טרופומיוזין-טרופונין (נבדק על ידי Ebashi ו- Endo, 1968, ו Gordon et al., 2000). כפי שנדון קודם לכן, Ca 2+ מחייב למיוזין הקרקפת מערער את המיוזין ממצב ה"כבוי "דמוי IHM, מנגנון שלא הופץ אבולוציונית במערכת החוליות. כמה עבודות מוקדמות של מעבדות ריצ'רד מוס ואחרים הראו כי רגישות Ca 2+ של קצב התפתחות הכוח בשרירי השלד החוליות מתווכת בין השאר על ידי יחידת המשנה RLC של גשר המיוזין (Metzger et al., 1989 מצגר ומוס, 1992 מצגר ומוס, 1990 מצגר ומוס, 1991). מחקרים אחרים הציעו את חשיבותן של קטיונים דו -ערכיים כגון Ca 2+ ו- Mg 2+ ביציבות מצב myosin SRX (Nogara et al., 2016a). רק לאחרונה דיווח מחקר כי Ca 2+ ולא Mg 2+ מחייב לנימי מיוזין לבביים מחודשים, מאכזבים את מצב SRX myosin, ובכך הציע הפעלה מתווכת Ca 2+ של נימה העבה כרגולציה נוספת של החוליות. שריר (Sa et al., 2019). האם מנגנון זה מתקיים בכל מיני מערכות שלד ולב נתון במחלוקת (אירווינג, 2017) ונשאר תחום חקירה פעיל. אם באמת, ויסות אמצעי Ca 2+ של אוכלוסיית SRX myosin מחזיק כל בסיס, זו תהיה דרך אבולוציונית נוספת לווסת את התכווצות השרירים, במיוחד בהקשר של הלב הפועם. יש צורך במחקרים נוספים הבודקים את תפקידו של Ca 2+ בוויסות מיוזין.

אנרגיית השרירים והתפקיד של ADP בניהול מצב myosin SRX

מבחינה פנוטיפית, על סמך מאפיינים כגון כוח התכווצות ומהירות, ניתן לסווג את סיבי שרירי השלד כאיטיים או מהירים, בהתאם לאיזופורמים השונים של המיוזין שהם מבטאים. לכן, קצבי חילוף החומרים והביצועים של כל השרירים תלויים בהתפלגות ובפרופורציה של סוגי שרירים שונים אלה. לאחרונה הוכח כי לסוג שריר השלד המהיר יש אוכלוסייה נמוכה יותר של מיוזינים במצב SRX מאשר סוג השריר האיטי (Phung et al., 2020), דבר המצביע על צריכת אנרגיה גבוהה יותר על ידי סוגי השרירים המהירים. צריכת אנרגיית מנוחה גבוהה יותר על ידי סיבי השריר המהירים עשויה לתרום להבדלים בקצב חילוף החומרים הבסיסי בכל הגוף ולספק תובנות נוספות להבנת אנרגיית השרירים.

בנוסף, חוסר תפקוד הקשור לאנרגיה עומד בבסיס מחלות נפוצות רבות, כגון הפרעות מיטוכונדריאליות, המשפיעות לעיתים קרובות על האיברים הצורכים ביותר באנרגיה בגוף כגון שרירי השלד והלב, המוח, הכבד והכליות. לדוגמה, בהקשר של התכווצות הלב, נדרשים אנזימים תלויי ATP הן עבור סיסטולה (למשל, מיוזין) והן עבור דיאסטולה (למשל, SERCA). זה כבר ניחש

60–70% מה- ATP המיוצר בשריר הלב נחשבים מנוצלים על ידי המיוזינים (Barclay, 2015). לכן כל אובדן באנרגיה כימית יוביל ללב כושל שאינו יכול לעמוד בדרישות ההמודינמיות של הגוף. חשוב לציין שכמות ה- ATP המיוצרת והשימוש בדקה גדולה פי כמה מהגודל של מאגר ה- ATP הקיים, ומדגיש כי שמירה על אספקת ATP גבוהה חשובה ביותר לשמירה על תפקוד הלב. ניתן להעלות על הדעת כי התכווצות יתר של הלב עקב מצבי מחלה כגון HCM או השפעות של אינוטרופים עלולה להפריע ליחס [ADP]/[ATP] ולגרום לחוסר איזון מטבולי (Ingwall and Weiss, 2004). כמה מחקרים דיווחו על תפקידו של ADP בהתבטאות מצב myosin SRX. לדוגמה, בסיבי שריר שלד מהירים ואיטיים של ארנב, מחייב ADP למיוזין מחבר את מנוע המיוזין חזק לאקטין ומזיז את החלבונים הרגולטוריים, ומפעיל את הסיבים. פעולה זו גורמת להפחתה אפשרית בתיווך זן של מצב ה- SRX של מיוזין, ובכך התקשרות של ראשי מיוזין נוספים לאקטין (סטיוארט ואח ', 2010). באופן דומה, לאחר טיפול ב- ADP, נצפו שיעורי מחזור של מצב SRX גם בסיבי שריר פסוס עכבר (Phung et al., 2018). מחקרים אלה מצביעים על כך שהחוט העבה בשרירי השלד, לאחר הקשירה לאקטין, יכול לעבור יציבות בתיווך זן של אוכלוסיית ה- SRX. מנגנון דומה נצפה גם במיוזינים של myofibrils שלד חולדות איטי של חולדה (Nelson et al., 2020). עם זאת, Hooijman et al., 2011 ציינו כי יציבות כזאת בתיווך ADP של אוכלוסיית ה- SRX ברקמת הלב מושפעת במידה פחותה ממצבי קפדנות-ADP של ראשי מיוזין סמוכים מכפי שנצפה בסיבי השלד. המחברים טוענים כי ניתן להסביר זאת על ידי אופי שיתופי חלש בהרבה של המיוזינים בשריר הלב בהשוואה לאלו שבשריר השלד. בנוסף, גורמים רבים נוספים כגון ההבדלים באיזופורמים ורמות זרחון של חלבונים אחרים כגון ROS myosin, MyBPC וטיטטין יכולים לתרום להבדלים אלה בשיתוף הפעולה של המיוזין ומהווה תחום פתוח לחקירה.

מעניין מאוד, בשרירי השלד, כאשר הפרעת ויסות בתיווך ADP של מצב SRX במיוזין נחקרה באורך סרקומר ארוך (ללא חפיפה בין אקטין-מיוזין), ADP לא שינה את מספר המיוזינים באוכלוסיית SRX אך הגדיל משמעותית את מחזור ATP שיעורי מיוזינים אלה, דבר המצביע על כך שקשירת ADP לכמה ראשי מיוזין מגבירה את קצב שחרור הפוספט מראשים סמוכים (סטיוארט ואח ', 2010). לאחרונה, באמצעות שימוש במיוזין לבבי חזירי, Gollapudi et al., 2020a הראו גם יציבות בתיווך ADP של אוכלוסיית ה- SRX של מיוזין בחוטים עבים של מיוזין מחדש, אך לא בתת-שברי המוסין S1 או במרוומיוזין כבד (HMM), דבר המצביע על ממסר. מנגנון של יציבות שיתופית של אוכלוסיית ה- SRX, באמצעות הזנבות הפרוקסימליים והדיסטאליים של מיוזין בתוך נימה העבה, אשר נעדר במבני המיוזין הקצרים יותר. מחקרים אלה עולים בקנה אחד עם התצפית כי הכריכה של ADP מייצרת תצורה פתוחה של מיוזין ומשבשת את הסדר הסלילי של נימה העבה בסיבי שריר פסואה ארנבת מתוחים (Xu et al., 2003). כל התוצאות הללו יחד מרמזות על המנגנון השיתופי של נימה העבה שבה מיוזין אחד הקשור ל- ADP (ולכן לא סביר שיהיה במצב SRX) יכול להקטין באופן מבני ותפקודי את אוכלוסיית המיוזינים האחרים במצב SRX (אלה שיש להם עדיין לא איבד את הפוספט שלו), ובכך עלול להפוך ראשי מיוזין סמוכים למצב 'מופעל' יותר. תצפיות אלה עשויות להצביע על כך שבהפרעות שרירים מטבוליות רבות, כולל ב- HCM, בהן יש הצטברות ADP בגוף, מיוזינים יהיו יותר במצב DRX הפעיל, ובכך לצרוך עוד יותר אנרגיה מהרגיל, ומכאן להחמיר את האפקט .

טמפרטורה: הגברת החום לייצוב אוכלוסיית SRX myosin

הטמפרטורה ממלאת תפקיד חיוני בכתיבת הדינמיקה של כמעט כל התהליכים הביולוגיים בגוף, ואין זה מפתיע שהטמפרטורה תשפיע על שיווי המשקל של מצב myosin DRX↔SRX.לדוגמה, בשרירי השלד, טמפרטורה גבוהה יותר גורמת לשיעור גבוה יותר של ראשי מיוזין למצב SRX ומאטת את זמן מחזור ה- ATP של מיוזינים אלה (סטיוארט ואח ', 2010), יתכן על ידי אכלוס מיוזין ב- ADP שבץ לפני הכוח. מדינת פי. מחקרים רבים תלויי טמפרטורה שעוקבים אחר ההתאמה של המיוזין גם ביססו את היווצרותם של יותר מיוזינים במצב ה'כבוי 'המבני והתייצבות המבנה הסלילי המסודר של נימה העבה עם עלייה בטמפרטורה (Xu et al., 2003 Fusi et al., 2015 Caremani et al., 2019). זה לא מפתיע. בשל האפקט ההידרופובי, רוב האינטראקציות בין חלבון לחלבון חזקות יותר בטמפרטורות גבוהות יותר. עם זאת, במערכת מיוזין לבבית שור מטוהרת, Rohde et al., 2018 הבחינו כי עם עליית הטמפרטורה, חלקו של המיוזין במצב SRX ירד במערכת S1 וללא השפעה במערכת HMM, בניגוד למה שנצפה על ידי המחקר הקודם של סטיוארט ואח ', 2010 בסיבי שריר השלד. תצפיות אלה מצביעות על כך שרשת האינטראקציות המולקולריות השולטות במצב SRX במערכת סיבי שריר מסובכת יותר שונות מאלו במערכת HMM או S1 מטוהרת, מה שעלול לגרום לתלות טמפרטורה שונה במערכות שונות. קיימת גם אפשרות להבדל מובנה בין אוכלוסיית מצבי ה- SRX במערכות שרירי השלד והלב (Hooijman et al., 2011). מחקר על השינויים באוכלוסיית SRX של מיוזין עם שינויי טמפרטורה באמצעות סוגי שרירים שונים מבעלי חיים שונים בדם קר וחם, ישפוך אור רב יותר על האינטראקציות המולקולריות המסדירות את היווצרות מצב SRX ועשוי לסייע לנו להבין את דינמיקת השרירים במצב שינה. חיות.

ה- MyBPC הנלווה ותפקידו בייצוב אוכלוסיית SRX myosin

MyBPC הוא חלבון הקשור לנימה עבה רב תחומים בשרירי השלד ושריר הלב הידוע כמווסת קינטיקה חוצה גשרים באמצעות זרחון של שאריות סרין במה שנקרא M-domain. מסוף C של MyBPC נקשר לנימה העבה, וקצה ה- N יכול לקיים אינטראקציה הן עם ראש המיוזין והן עם נימה האקטין. מספר מחקרים שנסקרו ב- McNamara et al., 2015 ו- Trivedi et al., 2018 הציעו תפקיד של MyBPC בייצוב ראשי המיוזין ליד נימה עבה של מיוזין ב'מצב חוץ 'דמוי IHM והזרחת ה- M- שאריות הסרין של התחום מעבירות את שיווי המשקל יותר לכיוון "במצב לא תקין". כיצד זה מתאם עם שיווי המשקל של מצב myosin DRX↔SRX? לראשונה דווח במחקר עם סיבי שריר לב עוריים שלעכברי נוקאאוט MyBPC הומוזיגוטיים אך לא הטרוזיגיים יש ירידה משמעותית באוכלוסיית המיוזין במצב SRX בהשוואה ל- WT (McNamara et al., 2016). בהתאם לתצפית מלמעלה למטה, גישת מלמטה כלפי מעלה עם מיוזין β-cardiac אנושי מטוהר הוכיחה לאחרונה כי אוכלוסיית המיוזין במדינת SRX גדלה בנוכחות שבר MyBPC C0-C7 (Sarkar et al., 2020) . שני המחקרים הללו מצביעים על כך ש- MyBPC מגדיל את אוכלוסיית המיוזין במצב SRX. עבודה זו נדונה עוד יותר בסעיף 'גורם למוטציות הגורמות ל- HCM ואחרות במיוזין לא מסדיר את מצב myosin SRX'.

במחקר אחר של עכברים (McNamara et al., 2019), הוכח עוד כי בגרסה פוספומימטית משולשת של MyBPC לבבי (DDD serine → שינויים באספרטט בשאריות 273, 282 ו -302 של תחום M של MyBPC), אוכלוסיית myosin SRX ירדה באופן משמעותי בהשוואה ל- WT ולגירסאות משולבות מסוג phospho-ablated של MyBPC (AAA serine → שינויים אלנין בשאריות 273, 282 ו -302). על חקירה נוספת של הפוספורילציות הספציפיות לאתר, המחברים הראו כי מספיקה גרסה פוספומימטית של אתר ser 282 (ADA serine → שינוי אספרטט בשאריות 282, ושינויים בסרין → אלנין בשאריות 273 ו -302) כדי להזיז את ה- DRX↔ שיווי משקל מצב SRX כלפי מצב DRX של מיוזין. מעניין לציין כי הגרסה הפוספומימטית ההפוכה (DAD serine → שינויים באספרטט בשאריות 273 ו -302 ושינוי אלנין בשרידים 282 אתרים) לא השפיעה על שיווי המשקל של מצב myosin DRX↔SRX. כמו מחקרים קודמים, טיפול בתכשירי WT עם חלבון קינאז A הפחית את המיוזין במצב SRX. לעומת זאת, לא הייתה השפעה בגרסה המוגבלת של פוספו של תכשירי MyBPC, מה שחיזק את ההשערה כי זרחון של MyBPC ממלא תפקיד מסדיר בהפיכת המיוזין ממצב 'כבוי' תפקודי למצב 'מופעל' יותר.

בהתחשב במציאות ש- MyBPC מתמקם לאזור C בסרקומר, דוח שנערך לאחרונה השתמש בהדמיה פלואורסצנטית חד-מולקולה של מיופיברילי שלד חולדה בתולדות נינוחות כדי למדוד את הקינטיקה של הידרוליזה של ATP באזורים שונים של הסרקומר (נלסון ואחרים. , 2020). המחברים פתרו מרחבית את הידרוליזה של מולקולות ATP בודדות המסומנות בפלואורסצנטי על ידי מיוזינים באזור C, אזור D ו- P. אזורי D ו- P הם אזורים של נימה עבה לכיוון קווי ה- Z ו- M, בהתאמה, ונטולי MyBPC. משך חיי ה- ATPase של מיוזין בתוך אזור ה- C היה ארוך יותר באופן משמעותי מאלו של האזורים הצמודים לא MyBPC. כמו כן, בתוך אזור C נצפו שתי אוכלוסיות מיוזין שונות התואמות את מצבי ה- DRX וה- SRX, בעוד שבאזורים שאינם מכילים MyBPC, כל המיוזינים היו בעיקר במצב DRX, דבר המצביע על כך שמיוציני SRX המעכבים מאוד קיימים בעיקר בתוך אזור C של סרקומר השלד. כל התצפיות הללו בונים יחד סיפור שבו קשירת MyBPC למיוזינים באזור C של הסרקומר המפוספס מאכלסת את מצב SRX, וזירחון MyBPC מעביר שיווי משקל זה יותר כלפי מצב DRX. תצפית זו עולה בקנה אחד עם הויסות המבני של החוטים העבים בשריר על ידי MyBPC (נסקרו ב- McNamara et al., 2015 ו- Trivedi et al., 2018) ומוסיפה את MyBPC כתורם חיוני שהתפתח בשרירים מפוספסים כדי לכוונן התכווצות מיוזין בעקיפין.

תת -שבר מיוזין 2: הזנב מספר סיפור על מצב ה- SRX של מיוזין

כפי שתואר לעיל, וכבר בשנת 2008, התגלה מצב מבני מקופל של מיוזין, המכונה IHM (נסקרו ב- Trivedi et al., 2018 ו- Alamo et al., 2018), שם שני ראשי S1 של מיוזין. מקפלים בחזרה באופן א -סימטרי לזנב S2. יתר על כן, ברמה המולקולרית, הוכח כי ראש S1 מתקשר עם החלק הפרוקסימלי של ה- S2 ביוכימית (Nag et al., 2017). אינטראקציות רבות אחרות, כגון S1 – S1 ו- RLC – RLC של שני ראשי המיוזין, מוצעות לייצב את מצב IHM. עם זאת, ממחקרים של מיקרוסקופ אלקטרונים, ניכר כי אינטראקציות S1 - S2 נדרשות ליצירת מצב ה"כבוי "המבני של המיוזין. האם תת -שבר S2 זה של מיוזין משנה גם את שיווי המשקל של מצב myosin DRX↔SRX? שאלה זו טופלה לאחרונה בדוח שבו נעשו שתי גרסאות שונות של HMM אנושי β-cardiac. האחד הכיל את 25 ההפטדים הראשונים של החלק הפרוקסימלי של תת-השבר S2 (25-hep), והשני הכיל רק את שני החוזרות הראשונות של תת-השבר S2 (2-hep). בניסויי ATP במחזור יחיד, ה- HMM בעל 25 הכבדות הראה התייצבות משמעותית של אוכלוסיית SRX myosin ל-

60%. לעומת זאת, אוכלוסיית ה- SRX ב- HMM עם 2 כבדות הייתה

20%, מה שמרמז כי תת-שבר ה- S2 הפרוקסימלי של מיוזין מעביר את שיווי המשקל של מצב myosin DRX↔SRX לכיוון מצב SRX. באופן עצמאי, מסקנה דומה הושגה גם על ידי Rohde et al., 2018 תוך חקירת אוכלוסיית ה- SRX ב- S1 לבבי בקר ו- HMM. הוכח כי תת-שבר S2 של מיוזין נקשר לקצה ה- N של ה- MyBPC (Gruen and Gautel, 1999) (נבדק ב- Trivedi et al., 2018). במחקר אחר, ריכוז גבוה של S2 פרוקסימלי שהתווסף לסיבי שריר הלב החדריים של העכבר הפחית משמעותית את מספר ראשי המיוזין במצב SRX (McNamara et al., 2019). השפעה זו נצפתה גם בגרסה המשולשת של פוספו המופרש של MyBPC (AAA serine → שינויים אלנין בשאריות 273, 282 ו -302 בתחום ה- M של MyBPC) (McNamara et al., 2019). תצפיות אלה מצביעות על כך ש- S2 אקסוגני יכול לדחוף את שיווי המשקל של מצב DRX↔SRX לעבר מצב ה- DRX של מיוזין, ככל הנראה באמצעות הפרעה של אינטראקציה בין MyBPC – מיוזין, מה שמסמן עוד יותר את תפקידו הפיזיולוגי של תת-שבריר מיוזין 2 (מיוזין S2) לאכלס את מצב ה- SRX . במשך זמן רב, בביולוגיה של שריר מפוספס, נתפסו שבר ה- myosin S2 יחד עם תחום הזנב לספק יציבות מבנית ותפקיד עיגון פסיבי למיוזין בחוט העבה. עם זאת, מחקרים ביוכימיים אלה החלו להאיר כי תחום מיוזין כגון S2, המרוחק מהאתר האנזימטי של החלבון, יכול לווסת את התכווצות השרירים על ידי שליטה באוכלוסיית המיוזינים במצב SRX, ובכך לספק מעבר אבולוציוני נוסף. להתכווצות שרירים.


מה גורם לשרירים להתכווץ?

תהליך כיווץ השרירים מתרחש בחוטי החלבון של הסרקומר.

הֶסבֵּר:

בדרך כלל השרירים נעים
על ידי תהליך שנקרא התכווצות הגורמת לקיצור בטן השריר. השרירים עובדים בהתנגדות. השריר המתכווץ נקרא האגוניסט, ואילו המתרגע נקרא האנטגוניסט. בטן השריר מורכבת מחבילות שרירים
סיבים הנקראים fascicles. סיבי השריר המורכבים מ myofibrils> שעושים למעשה את ההתכווצות בגלל יחידות מיוחדות הנקראות סרקומרים.

סרקומר פועל מ- z-lineto z-line. והוא מורכב מנימה עבה הנקראת מיוזין ונימה דקה הנקראת אקטין. כאשר האנרגיה משתחררת בצורה של ATP החוט העבה שנקרא מיוזין מסתובב במהירות רבה ומושך את שני החלבונים המצויים על נימה האקטין הדק. שני חלבונים אלה נקראים טרופומיוזין וטרופונין.

כאשר זה קורה, קווי ה- z נמשכים קרוב יותר והסרקומר מתכווץ. זה ידוע יותר בשם תורת נימה הזזה.

כאשר הסרקומר מתכווץ כל ההתכווצות של הסרקומרים והתכווצות המיופיבריל. ואז הסיבים מתכווצים והרכב ולבסוף, הבטן מתכווצת. כאשר הבטן מתכווצת היא מושכת את הגיד אשר בתורו מושך את העצם כדי לגרום לשלד לנוע.


אילו צעדים כרוכים במשיכת הכוח של המיוזין?

כל חלבון מוטורי של מיוזין מחזיק בפעילות ATPase ומתפקד באופן מחזורי המחבר בין קשירת ATP והידרוליזה לשינוי קונפורמטיבי בחלבון. תהליך זה מכונה מחזור & lsquopowerstroke & rsquo (נסקרת ב- [1] [2] [3]) ומתואר בשלבים שלהלן באמצעות myosin II כדוגמה. ט

מנגנון שבץ & rdquopower לתנועת מיוזין לאורך חוטי אקטין:

הכיוון בו ינוע נימה האקטין מוכתב על ידי האוריינטציה המבנית של מיוזין ביחס לנימה. סיבוב שלם של הידרוליזה ATP מייצר תנועה אחת או lsquostep & rsquo או תנועה של מיוזין לאורך נימה האקטין. תהליך זה מוסדר על ידי שינויים בריכוז הסידן החופשי התאי (נסקרת ב [4]). השלבים הכרוכים בפירוט להלן:

שלב 1: בסוף סבב התנועה הקודם ותחילת המחזור הבא, ראש המיוזין חסר ATP קשור והוא מחובר לנימה האקטין במתכונת קצרת מועד מאוד המכונה קונפורמציה & lsquorigor & rsquo.

שלב 2: קשירת ATP לתחום ראש המיוזין גורמת לשינוי קונפורמטיבי קטן באתר מחייב האקטין המפחית את זיקתו לאקטין וגורם לראש המיוזין לשחרר את נימה האקטין.

שלב 3: כריכת ATP גורמת גם לשינוי קונפורמטיבי גדול בזרוע ה- & lsquolever של myosin המכופף את ראש המיוזין למצב הלאה לאורך הנימה. ATP מועבר לאחר מכן והותיר את הפוספט האורגני ואת ה- ADP קשור למיוזין.

שלב 4: ראש המיוזין יוצר מגע חלש עם נימה האקטין ומתרחש שינוי קונפורמציה קל במיוזין המקדם את שחרורו של הפוספט האורגני.

שלב 5: שחרורו של פוספט אנאורגני מחזק את האינטראקציה המחייבת בין מיוזין לאקטין ובהמשך מעורר את שבץ ה- & lsquopower. שבץ הכוח הוא השלב המפתח ליצירת כוח המשמש את החלבונים המוטוריים של המיוזין. כוחות נוצרים על נימה האקטין כאשר חלבון המיוזין חוזר לקונפורמציה המקורית שלו.

שלב 6: כאשר המיוזין מחזיר לעצמו את הקונפורמציה המקורית, ה- ADP משתחרר, אך ראש המיוזין נשאר קשור היטב לנימה במיקום חדש מהמקום שבו הוא התחיל, ובכך מחזיר את המחזור להתחלה.


חומר ושיטות

ציר דגים

דגים גדלו וגדלו כמתואר לעיל [71]. נעשה שימוש באללים המוטנטים הבאים: unc45b sb60 [1], לְהַספִּיג תיקון [28], hsp90aa1.1 tu44c/tu44c , [9] smyd1b zf340/zf340 [13], כְּאֵב sb55 [29], וכן herzschlag (הל tg287 ) [72].

שיבוט

unc45b רצפים רגולטוריים שוכפלו לתוך הווקטור המתואר ב [32] המתאים ל- pT2KXIGΔin [73], שנמצא במעלה הזרם של חלבון הניאון הטונלי מונומרי 1 (mTFP1). לצורך שיבוט gata2 בונה כתבים מבוסס, ה unc45b שברים הוכנסו לפני gata2 מקדם [33] ביטוי מניע של gfp על ידי שיבוט Gateway [34]. unc45b רצפים במעלה הזרם הוגברו ומשוכפלים בהתאם לנהלים סטנדרטיים. פרטים זמינים על פי בקשה.

CDNA באורך מלא המקודד דג זברה hsf1 (IRBOp991H0894D, Imagene) הוגבר (פריימרים זמינים על פי בקשה). המוצר ה- PCR שהתקבל שוכפל לתוך וקטור המכיל 3.3 קילו-ביט unc45b רצף רגולטורי במעלה הזרם ובמסגרת של חלבון הניאון הכתום המונומרי 1 (mOrange1) [74]. אתרי איגוד TF זוהו עם Genomatix.

סופג מערבי

החלבון חולץ על ידי הומוגניזציה של עוברים מסולקים ומופרד על ידי 10 % SDS-PAGE, הועבר על מסנן ניטרוצלולוזה והודגרו עם נוגדנים ראשוניים שונים (1: 100 F59 DSHB ו- 1: 100 γ-tubulin, Sigma]) למשך לילה אחד 4 מעלות צלזיוס. לאחר שטיפה שלוש פעמים, נוגדן משני (עזים נגד עכברים אלקסה פלואור 680, אינויטרוגן) הוחל במשך שעה אחת בטמפרטורת החדר. כתמים דמיינו באמצעות מערכת הדמיה אינפרא אדומה (Odyssey LI-COR Biosciences).

הזרקה מיקרונית

הזרקה מיקרונית בוצעה כמתואר [75], בקצרה, 1.5–2 nl של תמיסת זריקה המכילה 20 ng/μl DNA plasmid כתב ו- 15 ng/μl Tol2 transposase mRNA, בתוספת 0.1 % פנול אדום (סמן הזרקה), הוזרק לתוך ביצי דג הזברה באמצעות מזרק FemtoJet (Eppendorf).

מורפולינוס (Genetools LLC, אורגון) הוזרקו באופן הבא: 0.3 מ"מ unc45b-mo (CCAATTTCTCCCATCGTCATTGAAG) [1] 0.1 מ"מ hsp90a-mo (TCGAG TGGTTTATTCTGAGAGTTTC) [9] 0.3 מ"מ smyd1b-mo (AAAAACTTCCAC AAACTCCATTCTG) [13] 0.3 מ"מ hsf1-mo (CACGGAGAGTTTAGT GATGATTTCT) [51] 0.3 מ"מ hsf1cont-mo (CACGCACAGTTACTGATCAT TTGT) 0.3 מ"מ hsf2-Mo (GACGTTCGA GCTGTGTTTCATTTTG) [51] ו- 0.4 מ"מ טיטין-מו (GTGGAAGACCGG TAAGATTACATCT) [77, 76].

הכלאה והדמיה באתרו

הכלאה במלואה באתרו בוצעה כמתואר [77]. בדיקה אנטי-חושנית כבולה נחשפה עם פוספטאז אלקליין אנטי-DIG (רוש). הבדיקות עבור mef2d, myoD, atf3, vgll2b, SRFl, klhl31, kbtbd10b, דמוי קלץ ', trim55b, mef2a, nr4a1, smyd1a, crip2, fhl2a5, סרקוזין 6 ו trim55a התקבלו מ [43] ול- unc45b, smyd1b, ו hsp90a מ [1, 13].

כל התמונות צולמו בעזרת מיקרוסקופ Leica (MZ16F) ומצלמת Leica (DFC320). עוצמת GFP ו- TPF נמדדה באמצעות ImageJ (http://imagej.nih.gov/ij/).

ניתוח RNA-Seq

בריכות של 20-50 עוברי דג זברה עם או בר unc45b פנוטיפ מוטנטי נאסף ב 24, 48 ו 72 hpf משני מצמדים עצמאיים. מיצוי RNA הכולל בוצע עם Trizol (Invitrogen) בהתאם לפרוטוקול היצרן. כל דגימות ה- RNA שחולצו נבדקו על ננו -שבבים של RNA (Bioanalyser 2100, Agilent) ולא הראו שום סימן להתדרדרות (מספר מדד RNA ו- gt 9). ספריות רצף נוצרו ממיקרוגרם אחד של דגימות RNA עם ערכת mRNA TruSeq v.2 (Illumina). גודל וריכוז ספריות הרצף נקבעו בעזרת שבב DNA (Bioanalyser 2100, Agilent) והריכוזים הותאמו ל -7 pM. דגימות מרובדות הועמסו במספר כולל של שלושה נתיבי רצף. קריאות קצה מזוודות (2 × 50 נוקלאוטידים) התקבלו ב- Hiseq1000 באמצעות ערכות SBS v3 (Illumina).

זיהוי אשכולות ושיחות בסיס בוצעו באמצעות RTA v.1.13 ואיכות הקריאות הוערכה באמצעות CASAVA v.1.8.1 (Illumina). הרצף הביא ל 302 מיליון זוגות קריאות באורך 50 נוקלאוטיד עם ציון איכות ממוצע של Phred & gt 35 (קובץ נוסף 1). הקריאות ממופות כנגד הגנום של דג הזברה (Zv9) באמצעות גירסת TopHat 1.4.1 [78] עם האפשרויות-חיפוש פרפר-חיפוש כיסוי-חיפוש מיקרו-5-p 5-סוג ספרייה -לא מתורגם ושימוש בצמתים אקסון ידועים (מהדורת אנסמבל 75). המרחק הממוצע וסטיית התקן בין זוגות קריאה התקבלו מ- CASAVA. ביטוי גנים נקבע עם גרסת HTSeq 0.5.3p3 [79] על ידי ספירת כל גן את מספר הקריאות שחפפו את מיקום ההערה שהתקבל משחרור אנסמבל 75. ביטוי דיפרנציאלי חושב באמצעות ר חבילה DESeq [79]. גנים עם שינוי פי 1.5 (הגדלה או הקטנה) ומותאמים עמ ערך (FDR) פחות מ- 0.05 נחשבו לביטוי דיפרנציאלי. האשכול ההיררכי בוצע ב ר עם ה gplots חבילה על קבוצה של גנים נבחרים המתבטאים באופן דיפרנציאלי לפחות במצב אחד עם המתאם של פירסון ושיטת הקישור המלא, תוך שימוש בנתוני ביטוי מיוצבים. אשכולות מטושטשים בוצעו על קבוצה של 1825 גנים המסודרים בצורה לא נכונה במצב אחד לפחות (FDR & lt 0.05) באמצעות הפרמטרים c = 6 ו- m = 1.25 [80].

נתוני הטרנסקריפטומיקה עבור כְּאֵב ו hsp90a -/ - מוטציות והאחים המקבילים מסוג wild-72 ב hpf נוצרו כמתואר קודם בשני נתיבים של 2 × 50 bp בשכפול או בשכפול (330 מיליוני זוגות קריאה), ומיושרים לגנום ההתייחסות כבעבר עם TopHat (קובץ נוסף 1) . הנתונים מ unc45b, כְּאֵב ו hsp90a מוטציות ב -72 hpf נותחו עם DESeq2, בעלות יכולת ניתוח טובה יותר בהשוואה ל- DESeq ובכך מזהות גנים מוטבעים יותר. החוסן של המשכפלים הביולוגיים מוצג במפת החום של מרחקים אוקלידים באיור S1a בקובץ נוסף 2 (לוח ימין). ברמה הגלובלית הניתוח של unc45b נתוני 72 hpf על ידי DESeq ו- DESeq2 מתואמים היטב, עם מקדם מתאם פירסון של השינוי פי פי log2 r = 0.82, מראה את הדמיון בין שתי השיטות.

מחקרי העשרה לטווח GO בוצעו על אשכולות גנים שהושגו על ידי אשכולות באמצעות Metacore (תומסון רויטרס) או על ידי חישוב עמ ערכים מהבדיקה המדויקת של הפישר. למטרה זו התקבלו אורתולוגים אנושיים מאנסמבל קומפרה לשאילת מונחים של GO ודרכי תהליכים מועשרים באופן משמעותי באשכולות השונים. לצורך סריקת אתרי קישור TF בגנים המתקבלים באשכולות ממוצעים מטושטשים, נותחו מקדמים הכוללים -1 kb ביחס לאתר ההתחלה של תעתיק על ידי Opossum [81] ו- Pscan [82]. אורתולוגים אנושיים לכל אשכול התקבלו מ- Biomart ורצף -1 kb מאתר ההתחלה של תעתיק שנסרק כמו קודם. כדי לחפש את אתר מחייב Hsf1 ברצפים רגולטוריים של 88 ה- TFs המוסדרים (FDR & lt 0.1 וקיפול שינוי & gt 1.5), -1 kb ל- +1 kb לאתר ההתחלה של התעתיק נסרקו עם Opposum v.3.0. פ ערכים חושבו מתוך ציוני Z גולמיים שהתקבלו מ- Opposum (עמ & lt 10 −20 ו- Z-score & gt 10 נחשבו כמשמעותיים).

אישור אתי

ניסויים בבעלי חיים בוצעו בהתאם לתקנים להגנת בעלי חיים בגרמניה ואושרו על ידי ממשלת באדן-וירטמברג, Regierungspräsidium Karlsruhe, גרמניה (Aktenzeichen 35-9185.81/G-137/10 ").


סקירה

מבוא

מיוזינים סרקומיים הקיימים בשריר מופשט יונקים הם מיוזינים מסוג II או קונבנציונאליים, כל מולקולת מיוזין המורכבת משתי שרשראות כבדות (MyHCs), שתי שרשראות קלות חיוניות (MLCs) ושני MLC רגולטוריים. שני MyHCs ו- MLCs נמצאים באיזופורמים שונים המקודדים על ידי גנים שונים. סך הכל 11 MyHCs מקודדים על ידי 6 שרשרת כבדה של מיוזין (MYH) גנים המתבטאים באופן נרחב בשרירי הגוף ו -5 גנים אחרים בעלי ביטוי מוגבל בשרירי שלד מיוחדים. חמישה MLC חיוניים מקודדים על ידי ארבע שרשרת קלה של מיוזין (MYL) גנים, ושני MLC רגולטורי על ידי שניים אחרים MYL גנים (טבלה 1) (ראה [1]). רוב הגנים הללו באים לידי ביטוי גם בשריר השלד המתפתח, כולל שני איזופורמים של MyHC, הנקראים מיוזינים עובריים ויילודים (או פרינטליים), המקודדים על ידי MYH3 ו MYH8, בהתאמה, ו myosin שרשרת קלה 1 עובריים/פרוזדורים, המקודדים על ידי MYL4 הגן, הנמצא ברמות גבוהות בשלבים הראשונים של התפתחות השרירים, מווסת לאחור לאחר הלידה, ומתבטא מחדש במהלך התחדשות השרירים. כאן, אנו בוחנים את דפוס הביטוי של גנים מיוזין במהלך התפתחות השרירים, תוך התמקדות במיוחד ב- MyHCs עובריים ויילודים. בנוסף, אנו דנים בפתולוגיות האנושיות עקב מוטציה של MYH3 ו MYH8 והשאלה הבלתי מעורערת של המשמעות התפקודית של מיוזינים אלה.

זיהוי מיוזינים התפתחותיים בשרירי השלד של היונקים

מספר מחקרים בשנות השישים והשבעים דיווחו על עדויות ביוכימיות המצביעות על כך שמיוזינים המבודדים משרירי עובר או שלד של העובר שונים מיוזינים של שרירים מבוגרים (ראו הפניות ב [2, 3]). עם זאת, Whalen et al. [2] היו הראשונים שסיפקו הוכחות חד משמעיות לקיומם של מיוזינים התפתחותיים מובהקים. הם זיהו שני MyHC ספציפיים, הנקראים עובריים ויילודים (נקראים גם לידה לילית), המכונים להלן MyHC-emb ו- MyHC-neo, אשר קודמים להופעתם של מיוזינים מהירים מבוגרים בשריר השלד של החולדה המתפתחת [2]. המקביל MYH גנים זוהו [4, 5] ונמצאו נמצאים באותו מוקד כרומוזומלי כמו הגן המקודד לשרשראות כבדות מיוזין מהירות למבוגרים בכרומוזום 11 (עכבר) או 17 (אנושי) [6]. הגן המקודד ל- MyHC-neo (MYH8) מראה דמיון רצף ניכר עם צום מבוגר MYH גנים, ואילו הגן המקודד ל- MyHC-emb (MYH3) שונה למדי (ראה [7] לניתוח רצף השוואתי של MYH גנים). שרירי השלד העובריים מכילים גם סוג ייחודי של MLC חיוני, MLC-1emb, המקודד על ידי MYL4 הגן, המתבטא גם בלב המתפתח וב שריר הלב הפרוזדורי המבוגר אך לא בשרירי השלד הבוגרים [8, 9].

מיוזינים התפתחותיים בחולייתנים אחרים

מיוזינים התפתחותיים קיימים גם בחולייתנים אחרים, כגון ציפורים ודגים, למרות שמשפחות גני המיוזין הסרקומרי עדיין מאופיינות באופן חלקי במינים אלה. זיהוי מיוזינים התפתחותיים בדגים מסובך על ידי מספר רב של גנים של מיוזין, הנובע מכפילות גנום שלם [10]. בעובר דג הזברה, גיוון של שושלות תאי השריר המהירים והאיטיים מתרחש מוקדם מאוד בהתפתחות, תחת שליטה של ​​מסלולי איתות ספציפיים, מה שמוביל למפרט אזורי של איזופורמים מהירים ואיטיים שונים של MyHC. שלושה גנים של מיוזין מסוג איטי, smyhc1, smyhc2, ו smyhc3, היוצרים מערך טנדם בגנום, מציגים דפוסי ביטוי דיפרנציאליים, כאשר סיבים איטיים ראשוניים מביעים בעיקר smyhc1 וסיבים איטיים משניים, הנוצרים בהמשך ההתפתחות, מבטאים smyhc2 ו smyhc3 [11]. שישה גנים של מיוזין מהירים, המסודרים כחוזרות משולשות הממוקמות באזור צר על קווצות מנוגדות של כרומוזום 5, מציגות גם דפוסי ביטוי מובהקים בעובר דג הזברה: הגנים בקבוצה 1 (fmyhc1.1, fmyhc1.2, ו fmyhc 1.3) אינם נכללים בזנב ומרוב שריר הגולגולת, ואילו הגנים בקבוצה 2 (fmyhc2.1, fmyhc2.2, ו fmyhc2.3) מתבטאים מאוד בשרירי הגולגולת [12].

בציפורים זוהו שלושה MyHC עוברי ויילוד אחד בפיתוח שרירי שלד (נבדק על ידי [13]). בנוסף, המיוטום והשרירים המתפתחים בעובר הגוזלים מכילים שלושה MyHCs מסוג איטי, המכונים SM1 (או MyHC1), SM2 (או MyHC2) ו- SM3 (או MyHC3), כאשר SM3 מתבטא גם בשריר הלב הפרוזדורי [ 13, 14]. MyHC החדר מתבטא גם באופן זמני בשרירי השלד של הגוזל העובריים ומתבטא מחדש במהלך התחדשות השרירים [14]. הביטוי של MyHCs מסוג איטי מתרחש בשרירי שלד ספציפיים ללא תלות בעצבנות, כתוצאה מקיומם של שושלות מובחנות של מבשרי מיוגנים (ראה [15]). המעבר מאיזופורמים התפתחותיים למבוגרים משתנה גם בשרירי העוף השונים: מעבר מוחלט מ- MyHC מהיר עוברי/ילודי למבוגר מתרחש בשריר החזה, אך רוב השרירים האחרים מכילים איזופורמים עובריים/ילודים כמרכיבים מרכזיים לאורך כל השלבים הבוגרים [13 ].

מיוזינים עובריים ויילודים במהלך התפתחות שרירי עכברים ועכברים

מיוזינים עובריים ויילודים התאפיינו במיוחד בפיתוח שרירי שלד של עכברים ועכברים. תמלילי MyHC-emb ו- MyHC-neo התגלו על ידי הכלאה באתרו בשלבי ההתפתחות המוקדמים: בעובר העכבר, MyHC-emb מזוהה לראשונה ב -9.5 ימים לאחר קויטום (E9.5) ו- MyHC-neo ב- E10.5 [16]. עדכון הוויסות של גנים אלה נשלט ככל הנראה על ידי הפעילות של גורמי הרגולציה המיאוגניים MyoD ו- Myf5, המעורבים במחויבות שרירים ובידול, שכן המקדמים הפרוקסימליים של גני מיוזין התפתחותיים מכילים תיבות E המגיבות ל- MyoD ו- Myf5 [17, 18]. שרירי השלד המתפתחים מבטאים גם מיוזין שלא ניתן להבחין בו מאיטי ה- MyHC המבוגר, המקודד על ידי MYH7, כפי שנקבע על ידי ניתוחים ברמת החלבון והתעתיק [19]. בהתבסס על דפוס התגובתיות של מספר נוגדנים נגד מיוזין, הוצע כי האיזופורמים מסוג MyHC האיטי הקיימים בשרירים העובריים שונים למעשה מאלה הנמצאים בשריר השלד הבוגר [20] אולם לפרשנות זו אין אושר. כמו כן, הוצע כי MyHC הטוניק האיטי, שזוהה לראשונה בשרירים החוץ-עיניים ובסיבי תוך-סירוב של צירים שרירים של השרירים הבוגרים [21] ונמצא לאחרונה כקודד על ידי MYH7b גן [22], הוא איזופורם איטי-התפתחותי המתבטא באופן נרחב ברוב השרירים העובריים [23]. למרות זאת, MYH7b תמלילים קיימים ברמות נמוכות מאוד בשריר העכבר העוברי ב- E12, וחלבון MYH7b אינו מזוהה בשריר העוברי והעובר באמצעות נוגדן פוליקונאלי ספציפי לתחום ה- N-Terminal של MYH7b, למעט סיבים נדירים, שזוהו לראשונה סביב E20, מיועדים להפוך לסיבי השקית של ציר השרירים (ראה [22]). לסיכום, עדויות זמינות מצביעות על כך ששלושה MyHCs קיימים ברמת החלבון בשריר השלד העכברוש והעכבר המתפתח: MyHC-emb (MYH3), MyHC-neo (MYH8) ו- MyHC-slow (MYH7). מחקרים אימונוהיסטוכימיים הראו שדפוס הביטוי של מיוזינים התפתחותיים משתנה בסיבים הנוצרים בשלבי התפתחות שונים. בסיבי הדור הראשוני של חולדות, MyHC-emb מתבטא יחד עם MyHC-slow [19, 24], ואילו סיבי הדור המשני מבטאים MyHCs עובריים ויילודים [25]. בשלבי העובר המאוחרים, מספר סיבי הדור הראשוני נוטים לאבד את MyHC-slow ולרכוש תגובתיות MyHC-neo, בעוד מספר סיבי דור שני בשרירים איטיים מכתים גם ל- MyHC-slow [25].

הפעלת גנים של MyHC במהלך מיוגנזה עובריים מלווה בהתאמות מקבילות של MLC וגנים אחרים של חלבון התכווצות. מחקרי הכלאה באתרו הראו כי תמלילי ה- MLC-1emb (MYL4) באים לידי ביטוי יחד עם MLC-1fast (תוצר השחבור העיקרי של MYL1 גן) החל בשלבי ההתפתחות המוקדמים בשריר השלד העובריים של העכבר הרמות היחסיות שלהם דומות ב- E12.5 אך MLC-1fast הופך לדומיננטי ב- E15.5 [16]. MLC-2 מהיר (MYL3) תמלילים קיימים גם בשלב מוקדם של אמבריוגנזה של עכברים, עם דפוסי ביטוי זמניים ומרחבים משתנים בקבוצות שרירים שונות [26]. לעומת זאת, תמלילי MLC-1 איטית/חדרית (MYL4) ו- MLC-3fast (עוד מוצר שחבור של MYL1 גן) אינם ניתנים לזיהוי בשרירים המתפתחים לפני E15 [16].

מתג מיוזין עוברי/יילוד-מבוגר

מיוזינים התפתחותיים נעלמים ברוב שרירי השלד במהלך ההתפתחות המוקדמת לאחר הלידה במקביל לוויסות הווסת של מיוזינים מהירים למבוגרים. בשרירי השלד של רגל החולדה, התמלילים של MyHCs מהירים למבוגרים (MyHC-2A, MyHC-2X ו- MyHC-2B, מקודדים על ידי MYH2, MYH1, ו MYH4, בהתאמה) מתגלים לראשונה מספר ימים לאחר הלידה על ידי הכלאה באתרו והופכים להיות דומיננטי בשבועות הבאים [27]. מעבר זה מתרחש מוקדם יותר בשרירי השלד של העכבר, שכן ניתן לזהות כמויות קטנות של תמלילי מיוזין מהירים למבוגרים עוד לפני הלידה באמצעות מבחני הגנה רגישים ל- RNAase ועל ידי הכלאה באתרו [28]. עם זאת, ברמת החלבון, שרירי העכבר המהירים מכילים בעצם MyHC-neo (כ -70 %) ו- MyHC-emb (כ -30 %) עם עקבות של MyHC-slow, כפי שנקבע על ידי אלקטרופורזה בג'ל ברזולוציה גבוהה [29]. העיתוי של הורדת ויסות מיוזין עוברי ויילוד והתאמות מיוזין מהירות של מבוגרים מראה שונות משמעותית בין שרירי הגוף, הן ברמת ה- mRNA [28] והן ברמת החלבון [29]. חיסולו של מיוזין התפתחותי עשוי להשתנות גם בתוך אותו שריר, למשל, נמצא שמיוזין יילוד נמשך זמן רב יותר בסיבי סוג 2A במהלך ההתפתחות שלאחר הלידה [30]. מעניין לציין כי העיתוי של הורדת ויסות של איזופורמים MyHC התפתחותיים השתנה למעשה MYH4 (2B) ו MYH1 (2X) עכברי null [31].

המעבר מ- MyHCs מהירים להתפתחות למבוגרים הנראה בשרירים מהירים של מכרסמים מתרחש גם בתאי שריר מתורבתים. דווח כי תאי שריר C2C12, כאשר הם נגרמים להתמיינות בעת העברה למדיום סרום נמוך, מבטאים תחילה תמלילי MyHC-emb, MyHC-neo ו- MyHC-slow, החל מהיום הראשון והשיאם ביום 2-4 ואז יורדים, ואילו תמלילי MyHC-2A, MyHC-2X ו- MyHC-2B מתחילים לעלות ביום 2-4 ומגיעים לשיאם ביום 8 (נקודת הזמן האחרונה שנבדקה) [32]. עם זאת, ישנן תוצאות שנויות במחלוקת לגבי תבנית הביטוי MyHC בתרביות תאי לוויין משרירי שלד שונים (ראה [33, 34]), ושרשרת כבדה מיוזין ספציפית לעיסה (Myh16) זוהתה בתרבויות של שרירי לסת חתול אך לא בשרירי גפיים. , דבר המצביע על כך שתאי שריר משרירי סגירת לסת מתוכנתים מראש לביטוי איזופורמים אלו במהלך המיאוגנזה במבחנה [35].

ניתן לשנות את המעבר ההתפתחותי מ- MyHCs התפתחותיים למבוגרים על ידי השפעות הורמונאליות ועצבניות חיצוניות. מתג המיוזין המהיר העוברי/יילוד למבוגר נמצא תחת שליטה של ​​הורמון בלוטת התריס, היפרתירואידיזם מעורר ביטוי מוקדם של mRNA שרשרת כבדה מהירה של מבנה מיוזין והיפותירואידיזם המשרה עיכוב במעבר זה [36–38]. לעומת זאת, פעילות עצבית ככל הנראה אינה הכרחית למתג המיוזין העוברי/יילוד-מהיר [39, 37] אך נדרשת לקדם הצטברות לאחר הלידה של MyHC-slow והיעלמות MyHC-emb בשריר הסוליה האיטי [ 19].

המנגנונים המולקולריים השולטים במתג המיוזין במהלך הפיתוח נותרו עדיין מבוססים וככל הנראה כוללים רצפים רגולטוריים ספציפיים הקשורים ל- MYH אשכול גנים, היכן MYH הגנים מסודרים לפי הסדר: MYH3-MYH2-MYH1-MYH4-MYH8-MYH13. דווח כי הורמון בלוטת התריס שולט במעבר בין 2B MyHC מהיר ליילוד ומבוגר על ידי רנ"א אנטי-סנס ארוך שאינו מקודד המוסדר בתעתיק במהלך התפתחות לאחר הלידה ובתגובה לבלוטת התריס: RNA אנטי-סנס זה מתועתק מאתר בתוך האזור הבין-גני. בֵּין MYH8 (MyHC-neo) והקשר הדוק MYH4 הגן (MyHC-2B) ונראה שהוא מתווך את ההדחקה של תעתיק ה MYH8 גן [40]. משפר מרכזי הממוקם בין MYH3 ו MYH2 גנים זוהו לאחרונה [41]. משפר זה, שתפקודו נשלט על ידי שישה הומאופרוטאינים, פועל cis על ידי עדכון הביטוי של מהיר MYH גנים (MYH2, MYH1, ו MYH4), הממוקם במורד הזרם של המשפר, ובמקום עָבָר באמצעות RNA ארוך-אינטגני שאינו מקודד (linc-Myh) כדי לדכא את הביטוי של MYH7 (MyHC-slow) [41]. עם זאת, לא ידוע אם משפר זה מעורב גם בוויסות גנים מיוזין התפתחותיים, MYH3 ו MYH8, ובכך להתנהג כמו א MYH אזור בקרת לוקוס (LCR) הדומה לזה הקיים ב β-globin לוקוס, או אם LCRs אחרים, הקשורים ל- MYH אשכול גנים, לשלוט בהתפתחות MYH החלף.

שינויים במיוזין בשריר השלד האנושי המתפתח

דפוס ההתפתחות של ביטוי איזופורם של מיוזין בשריר השלד העובריים והעובריים של האדם נחקר פחות. בשבוע 8 להריון, סיבי הדור הראשוני עם גרעינים מרכזיים נמצאים בשריר השלד האנושי, בעוד שסיבי הדור המשני נוצרים לאחר שבוע 10 והופכים לאוכלוסיית הסיבים השלטת עד שבוע 21 [42]. תמלילי MyHC-emb, MyHC-slow ו- MyHC-neo מזוהים בשריר השלד המתפתח בשבוע 9 (איור 1). ברמת החלבון, כל myofibers הראשי מבטאים את MyHC-emb ו- MyHC-slow [43, 44], כאשר MyHC-emb ניתן לזיהוי לפני MyHC-slow במיוטוביות הראשוניות [45]. שיעור הסיבים המכתים ל- MyHC-slow יורד מ -75 % בשבוע 10 ל- 3 % בשבוע 21 להריון, בשל הגידול הדרמטי בסיבים משניים שבתחילה אינם מכילים MyHC-slow [45]. סיבי הדור המשני מבטאים רק MyHC-emb בשבוע 12, חלבון MyHC-neo מזוהה בשלבים מאוחרים יותר [45]. ניתוח RNA כמותי מצביע על כך MYH3 תמלילים מהווים כ -81 % מכולם MYH תמלילים בשריר השלד העובר האנושי בשבוע 15 להריון [46]. בשבוע 16 עד 17, זוהתה אוכלוסיית סיבים שלישוניים, המורכבת בתחילה ממיופייבר קטן מאוד המוכתם על ידי נוגדן אנטי-מיוזין המגיב עם צום מבוגר אך לא עם MyHC בילוד [44, 47]. הכלאה באתרו מצביעה על כך שתמלילי MyHC-2A באים לידי ביטוי באופן חלש בשבוע 19 ובעוצמה רבה יותר בלידה, בעוד שתמלילי MyHC-2X כמעט אינם נמצאים בלידה ומתבטאים בבירור ב -30 יום לאחר הלידה (איור 1). לאחר שבוע 27, חלק מהסיבים המשניים מתחיל לבטא איטי MyHC, ועד שבוע 30, כ -50 % מכל סיבי השריר מבטאים איטי MyHC, כמו בשריר מבוגר [45, 44]. בשרירים האנושיים המתפתחים, שני האיזופורמים ההתפתחותיים של MyHC יורדים לכיוון סוף ההריון, תמלילי ה- MyHC המתאימים באים לידי ביטוי ברמות נמוכות בלידה, ובתינוק בן חודש, MyHC-neo ממשיך רק בכמה סיבים [ 48] (איור 1). לסיכום, נראה כי רוב סיבי שרירי השלד האנושיים, ככל הנראה יותר מ -95 %, נובעים מגלים מיוגנזיים משניים ושלישוניים והתפשטותם לשושלת מהירה מסוג 2A או איטית מסוג 1 מתרחשת לפני הלידה, במהלך השליש השלישי להריון, ואילו ההתמיינות של סיבי סוג 2X מתרחשת בשבוע הראשון לאחר הלידה.

תמלילי MyHC בפיתוח שריר השלד האנושי. התמלילים נחשפו על ידי הכלאה באתרו באמצעות בדיקות ספציפיות להלן MYH גנים: MYH3 (להטביע, אד), MYH8 (ניאו, הח), MYH7 (לְהַאֵט, אניl), MYH2 (2 א, Mעמ), וכן MYH1 (2X, שt). השרירים שנבדקו היו quadriceps femoris מעוברים בני 9 ו- 19 שבועות ו- vastus lateralis מילודים של יום אחד (P1) וחודש (P30). בָּר = 30 מיקרון (מ [48])

בשריר הארבע ראשי האנושי המתפתח ניתן לזהות שלושה חלבוני MLC על ידי אלקטרופורזה של ג'ל דו -ממדי בין שבוע 7 ל -12 [49]. MLC-3fast הופך להיות גלוי בבירור בשבוע 25, כאשר MLC-1emb מתחיל לרדת במהירות. השינוי העיקרי במהלך השליש השלישי להריון הוא הצטברות פרוגרסיבית של האיזופורמים האיטיים של MLC, כך שבלידה פרופיל ה- MLC דומה לזה של שריר מבוגר [49]. תמלילי MLC-1sa ניתנים לזיהוי גם בשרירי השלד האנושיים בשבוע 24, אם כי ברמות נמוכות משמעותית בהשוואה לשריר המבוגר [50].

מיוזינים התפתחותיים בשרירי השלד הבוגרים

MyHCs התפתחותיים נמשכים לאורך כל השלבים הבוגרים במספר סיבים הנמצאים בשרירים מיוחדים, כולל השרירים החוץ-עיניים [51, 52] וציר השרירים [53, 54, 23], כמו גם השרירים שסוגרים את הלסת [55–57] ו שרירי הגרון [58]. MLC-1emb/פרוזדורים קיים גם בשריר המסת האדם הבוגר [55] והוא ה- MLC החיוני הבלעדי או השולט הקשור ל- MyHC-M (MYH16) בשרירי סגירת הלסת של טורפים ומיני יונקים אחרים [59, 60]. מחקר פרוטאומי שנערך לאחרונה על סיבים בודדים משריר השלד של העכבר הבוגר גילה כי עקבות MyHC-emb ניתנות לזיהוי בכל myofibers מבוגרים, בעוד שכמויות קטנות של MyHC-neo נמצאות בסיבי שריר מהירים [61]. MyHC-emb זוהה גם בשריר השלד האנושי הבוגר [62]. בשרירים החוץ-עיניים, הסיבים המבטאים את MyHC-emb ממוקמים במיוחד בשכבת המסלול (איור 2 א) ומראים שינויים בביטוי לאורך הסיבים, בשפע יותר באזורים הרחוקים ופחות בשפע באזור המרכזי ( ראה [63]).בשרירים אלה, מיוזין עוברי מתבטא בדרך כלל יחד עם סוגי מיוזין אחרים [63], כולל MYH15 החדש [22]. בשני סוגי הסיבים הקיימים בצירים השרירים, שרשרת הגרעין וסיבי השקית הגרעינית, MyHC-emb ו- MyHC-neo ממוקמים ברובם בסיבי שרשרת גרעינית (איור 2 ב). העוברי והיילוד MYH גנים יכולים להיגרם על ידי תת פעילות של בלוטת התריס בשרירים מבוגרים ספציפיים [64]. שיתוק שרירים הנגרם על ידי כריתה של העצב או על ידי חסימת הולכה עצבית הנגרמת על ידי טטרודוטוקסין מוביל גם לביטוי מחדש של מיוזינים התפתחותיים, המתרחש במיוחד בסיבי סוג 2A אך מוגבל בדרך כלל לפלחי סיבים קצרים [30].

MyHC עובריים בשרירי השלד הבוגרים. א חלקים רוחביים של שריר חוץ-עיני חולדה (rectus superior) הגיבו עם נוגדן חד שבטי ספציפי ל- MyHC-emb (BF-G6, ראה [76]). שים לב שמיוזין עוברי מתבטא ברוב הסיבים של שכבת המסלול (או) אך רק בסיבים נדירים של השכבה הגלובלית (ז) של השריר. בָּר = 100 מיקרון. ב מיוזין עוברי בסיבי תוך -סירוב של צירים שרירים. חלקים סדרתיים של שריר סולוס חולדה שנראים בניגוד פאזה או מוכתמים עבור MyHC-emb (MYH3), MyHC-slow-tonic (MYH7b), או MYH15 (MYH15). מיוזין עוברי מזוהה בסיבי השרשרת הגרעינית של ציר שריר (3 ו 4) אך לא בסיבי השקית הגרעינית (5 ו 6), וגם לא באזור החוץ -קופסי של ציר סמוך (סיבים 1 ו 2). סיבי שריר חוץ -סיריים (כּוֹכָבִית) אינם מוכתמים. בָּר = 20 מיקרון (שונה מ- [22])

ביטוי מחדש של מיוזינים התפתחותיים בהתחדשות השרירים

שרירי השלד יכולים להתחדש ביעילות לאחר סוגים שונים של פציעות (ראה סקירה [65]). התחדשות השרירים מתווכת על ידי תאי הלוויין הנמצאים מתחת לשכבת הבסיס של סיבי השריר, המופעלים לאחר פציעה ועוברים ריבוי והתמזגות, ובכך יוצרים סיבי שריר חדשים. חידוש סיבי השריר מבטא מחדש איזופורמים התפתחותיים של מיוזין, טרופונין וחלבוני שריר אחרים [66, 67, 3]. MyHCs עובריים ויילודים מזוהים ב- myofibers מתחדשים שנוצרו תוך 2-3 ימים לאחר הפציעה ונמשכים 2-3 שבועות (איור 3 א). MLC-1emb מתבטא גם באופן חולף בהתחדשות שרירי השלד [68]. ביטוי מחדש של מיוזינים התפתחותיים יכול להתגלות במגוון מצבים הכוללים אירועי התנוונות/התחדשות שרירים, כולל הזרקה של ארסי הנחש נוטקסין וקרדיוטוקסין [69, 70], דנרציה כרונית [71], או נזק לשריר הנגרם כתוצאה מחשמל כרוני. גירוי [72]. נוכחותם של מיוזינים התפתחותיים מייצגת אפוא סמן שימושי להתחדשות השרירים במודלים של בעלי חיים של מחלות שרירים, כגון חסר דיסטרופין. mdx מודל עכבר של ניוון שרירים [73] ובמיופטיות אנושיות, כגון ניוון שרירים של דושן [74] או פולימיוסיטיס (איור 3 ב). נוכחותו של מיוזין עוברי יכולה להיות גם סמן שימושי באבחון של רבדומיוסרקומה [75, 76].

MyHC עובריים בהתחדשות סיבי שריר. א ביטוי של מיוזין עוברי בהתחדשות שרירי שלד חולדות בתקופות זמן שונות לאחר פגיעה הנגרמת על ידי bupivacaine. ניתן לעקוב אחר התקדמות התחדשות השרירים מהיום 3 עד היום 14 לאחר הפציעה בחלקים סדרתיים המוכתמים בהמטוקסילין ואוזין (לוחות עליונים) או מוכתם כנגד מיוזין עוברי (לוחות תחתונים). שימו לב להיעדר מיוזין עוברי בשריר השליטה. בָּר = 50 מיקרון (שונה מ [65]). ב חידוש סיבי שריר מכתים למיוזין עוברי במיופתיות אנושיות. קטע של ביופסיה של שריר האדם מחולה עם פולימיוסיטיס מוכתם ל- MyHC-emb (אָדוֹם) ולמינין (ירוק). שימו לב למספר הרב של סיבי השריר המתחדשים המגיבים למיוזין עוברי. בָּר = 50 מיקרון (באדיבות אלנה פגורארו)

המעבר ממיוזינים מהירים עובריים/יילודים למבוגרים בשריר המתחדש אינו תלוי בעצבנות, ואילו המעבר למיוזין איטי נשלט על ידי פעילות עצבית איטית [69, 66, 70]. במודל שנמצא בשימוש נרחב, עם פגיעה בשריר הנגרמת על ידי הזרקת bupivacaine בשריר הסולאוס האיטי של החולדה, התפתחות מיופייבר מבטאת רק תמלילי מיוזין עובריים ויילודים ביום 2-3 לאחר הפציעה, אך, ביום 4, מתחילים לבטא mRNAs מיוזין מהיר למבוגרים. עם זאת, בנוכחות העצב, המוסין האיטי מווסת במהירות ותמלילי מיוזין מהירים מווסתים, בעוד שבהיעדר העצב ממשיכים להצטבר מיוזינים מהירים למבוגרים ותמלילי מיוזין איטיים נותרים בלתי ניתנים לגילוי [77]. תהליך זה מתווך על ידי דפוס הפעילות העצבית, שכן ניתן לשחזר אותו על ידי גירוי חשמלי של השריר המתחדש באמצעות דפוס גירוי המחקה את פעילות הנוירון המנוע האטי האנדוגני [78]. עם זאת, התחדשות השרירים המהירים והאיטיים מגיבים באופן שונה לאותו דפוס גירוי, ותומכים באפשרות שהמתג מיוזין מהיר או ילודי למבוגר משקף את קיומם של הבדלים מהותיים בין אוכלוסיות תאי הלוויין בסוגי הסיבים השונים. פרשנות זו עולה בקנה אחד עם מספר מחקרים על תאי שריר מתורבתים אולם סוגיה זו נמצאת מחוץ להיקף סקירה זו.

הפרעות מולדות בבני אדם כתוצאה ממוטציות של מיוזינים עובריים ויילודים

תפקידו המכריע של מיוזין עוברי ויילוד במהלך התפתחות האדם הוכח לאחרונה על ידי ההשלכות הפתולוגיות של MYH3 ו MYH8 מוטציות (ראה [79]). מוטציות ב MYH3 הגן (MyHC-emb) אחראי לסוגים מסוימים של תסמונות ארתרוגריפוזיס דיסטליות (DA), הפרעות מולדות המאופיינות בהתכווצויות איברים מרובות [80]. MYH3 מוטציות גנטיות נקשרו לשתי תסמונות DA גדולות, DA2A ו- DA2B/DA1. תסמונת פרימן-שלדון (FSS, DA2A) מאופיינת בהתכווצויות פנים ועקמת מולדת, בנוסף להתכווצויות של הגפיים. זוהי התסמונת החמורה ביותר מבין החולים והמטופלים דורשים התערבות תזונתית, כירורגית ושיקומית [81]. FSS הייתה ידועה גם בשם "תסמונת שורק הפנים", מכיוון שהשפתיים נראות מכווצות או צבטות ומשאירות רק פתח אוראלי קטן. למעשה, עד כה, הסיבה היחידה המזוהה ל- FSS היא מוטציה בגן MYH3. DA2B (תסמונת שלדון-הול, SHS) ו- DA1, הנראים כמייצגים את הקצוות של אותו מצב משתנה פנוטיפי והטרוגני גנטי, יכולים לנבוע גם מ MYH3 מוטציות [82]. עם זאת, DA2B ו- DA1 יכולים להיגרם גם על ידי מוטציות ב TNNI2, קידוד לטרופונין מהיר I, TNNT3, קידוד לטרופונין T מהיר, ו TPM2, קידוד ל- β-tropomyosin.

רוב MYH3 מוטציות ב- DA2A ו- DA2B אינן חופפות, מה שמרמז על קשר בין MYH3 גנוטיפ ופנוטיפ (איור 4), וגם בתוך DA2A מספר היבטים של הפנוטיפ קשורים למוטציות ספציפיות [80]. שְׁלוֹשָׁה MYH3 מוטציות הכוללות שאריות שמורות, T178I, R672H ו- R672C, מהוות יותר מ -90 % מכלל MYH3 מוטציות הגורמות ל- FSS, כאשר T178I הוא החמור ביותר ו- R672C הפחות [81]. עם זאת, T178I נקשרה גם ל- SHS. שאריות R672 ו- T178 מתמפות לחריץ הסמוך לאתר מחייב הנוקלאוטיד, מה שמרמז שמוטציה של שאריות אלה עשויה לשנות את האתר הפעיל המקיף את אתר מחייב הנוקלאוטיד. לעומת זאת, שאריות המוטציות ב- SHS מתמקמות בדרך כלל למשטחים שעשויים לקיים אינטראקציה עם חלבונים אחרים של המכשיר התכווצות כגון אקטין וטרופונין: זה יכול להסביר מדוע פנוטיפ דומה של SHS יכול להיגרם על ידי TNNI2 ו TNNT3 מוטציות (איור 4).

MYH3 מוטציות הגורמות לארתרוגריפוזיס דיסטלי. א תוכנית של מולקולת המיוזין העוברי המציגה אתרים של מוטציות שונות הגורמות לתסמונת פרימן-שלדון (FSS, מֵעַל) ותסמונת שלדון-הול (SHS, לְהַלָן). שים לב שרוב המוטציות מתמקמות לתחום הראש של מולקולת המיוזין, וכי מוטציות הגורמות ל- FSS שונות מאלו שגורמות ל- SHS. ב מודל של מכלול האקטין-מיוזין. חלק מנימה האקטין הכולל חמישה מונומרים אקטין מוצג כסרט אפור כהה. שרשרת כבדה של מיוזין (שרשרת כבדה), שרשרת אור חיונית (ELC) ושרשרת אור רגולטורית (RLC) מוצגים כ כָּחוֹל, תפוז, ו סרטים ירוקים, בהתאמה. MYH3 מוטציות הגורמות לארתרוגריפוזיס דיסטלי מוצגות עם אטומי מילוי שטח גדולים, כאשר מוטציות FSS צבעוניות אָדוֹם ומוטציות SHS צהוב (שונה מ [80])

MYH8 מוטציות (MyHC-neo) אחראיות לצורה אחרת של ארתרוגריפוזיס דיסטלי (DA7), המכונה תסמונת הטריזמה-פסאודוקמפטודקטי (TPS) מכיוון שהחולים אינם יכולים לפתוח את הפה במלואו (טריזמה) ולהראות קמפטודקטיות יוצאת דופן (כיפוף האצבעות) ) זה ניכר רק על ספיגה של מפרק כף היד (כלומר, pseudocamptodactyly). בניגוד למספר הגדול של MYH3 מוטציות הגורמות ל- FSS ו- SHS, יחידה אחת בלבד MYH8 מוטציה (R674Q) זוהתה במשפחות שונות עם תסמונת trismus-pseudocamptodactyly [83, 84]. השאריות המושפעות R674, שבגלל מספור שונה תואמת ל- R672 בגן MYH3 שתואר לעיל, נשמרת במיני חוליות שונים ובזנים שונים MYH קידוד גנים למיוזינים סרקומיים. שארית זו ממוקמת בסמוך לאתר מחייב ATP ועלולה בכך להפריע לפעילות קטליטית של מיוזין. במשפחה שתוארו על ידי Veugelers et al. [84], TPS נמצא קשור לביטויים האופייניים למכלול קרני, כולל נוכחות של מיקסומות לבביות, מה שמרמז על תפקיד אפשרי של MYH8 גן בהתפתחות הלב. עם זאת, קשר זה לא נמצא במשפחות שדווחו על ידי טוידמיר ואח '. [83], ו- TPS מעולם לא נצפתה באוספים גדולים של מקרים מורכבים של קרני [85].

כיצד ניתן להסביר את ההתכווצויות המולדות הנגרמות על ידי מוטציות במיוזינים התפתחותיים? פרשנות מתקבלת על הדעת היא זאת MYH3 אוֹ MYH8 מוטציות גנטיות מפריעות לפעילות הקטליטית של מיוזין בשל ההשפעה השלילית הדומיננטית של האלל המוטציה, ובכך גורמות לפגמים בייצור כוח myofiber ברחם. יש צורך בתנועות אקטיביות של העובר להתפתחות תקינה של המפרקים, כפי שמראה מחקרים קלאסיים בעובר הגוזל [86, 87]. מחקרים אלה הראו כי שיתוק שרירים הנגרם באובו על ידי סוכני חסימה נוירו -שרירים, כגון curare או בוטולינום טוקסין, גורם לארתרוגריפוסיס. הדיסמורפיזם של orofacial הנגרמת על ידי MYH3 אוֹ MYH8 מוטציות גנטיות עשויות לשקף תפקיד דומה של התכווצות שרירי הבעת הפנים בעיצוב צורת הפנים במהלך התפתחות העובר.

ההשקפה שמוטציות של MYH3 ו MYH8 להוביל להתכווצות יתר של שרירי העובר קיבל תמיכה משני ממצאים אחרונים. ראשית, השינוי במחזור הגשר בין חולים הנושאים מוטציה R672C אושר על ידי ניתוח מפורט של מכניקת myofibril וסיבים בודדים [62]. שנית, תוצאות ראשונות עם מיוזין S1 מבודד (תת -פרגמנט 1), החלק של מולקולת המיוזין הכוללת את ראש מיוזין וזרוע המנוף, המספיקה להניע תנועת הזזה אקטין במבחני תנועתיות חוץ גופית, הראו כי מספר פרמטרים קינטיים של הצלב מחזור הגשר משתנה בנוכחות מוטציות R672C, R672H ו- T178I FSS [88].

תכונות התכווצות של מיוזינים עובריים ויילודים

מחקרים חלוציות בשנות השישים הראו כי מעבר בתכונות התכווצות מתרחש בסביבות או ממש לאחר הלידה בשרירי חתול [89, 90] ושרירי חולדה ([91, 92], ראה [93] לסקירה), כפי שמתואר באיור 5 א. , ב. במהלך השבוע הראשון להתפתחות לאחר הלידה, הכוח האיזומטרי עולה בשרירים האיטיים והמהירים כאחד, בעוד שמהירות הקיצור המקסימלית עולה בשרירים המהירים אך לא באיטיות. ניתן להסביר את העלייה בכוח על ידי הוספת myofibrils במקביל (אך ראה להלן), אולם השינוי במהירות הקיצור המקסימלית מצביע על שינויים באיזופורמים של מיוזין, הנחשבים כגורמים העיקריים למהירות הקיצור המקסימלית ופעילות ATPase [94 ]. תמיכה נוספת לפרשנות זו ניתנה על ידי התבוננות בעלייה מקבילה בפעילות myosin ATPase במהלך הפיתוח [92], בעוד שההאצה בקצב עליית המתח והפחתת פרמטרי זמן העווית משקפים ככל הנראה תרומה מתכנסת של שינויים בקינטיקה של מיוזין ו התבגרות של הרשתית הסרקופלסמית [92, 95].

תכונות קינטיות של מיוזין בילודים. א, ב שינויים לאחר הלידה במהירות הקיצור המקסימלית (א) ופעילות ATPase (ב) בחולדה extensor digitorum longus (EDL) שריר. שים לב שההחלפה ההתפתחותית של מיוזין יילודים במיוזין מהיר למבוגרים במהלך השבוע הראשון לאחר הלידה מלווה בעלייה כפולה ב- Vמקסימום ופעילות ATPase. (לוּחַ א מסומן מחדש מלוח 1 מתוך [91], לוח ב צייר מחדש מאיור 3 (א) של [92]). ג מהירות הקיצור שלא נטענה של סיבים בודדים של פסואות ארנבות עולה בשלבים שלאחר הלידה במקביל להחלפת ילודים באיזופורמים מהירים למבוגרים (שצוירו מנתונים בטקסט ובאיור 2 של [96]). ד פעילות Myofibrillar ATPase של סיבים בודדים המבודדים משריר הסרעפת של חולדות בילודים ומבוגרים ומזוהים ביחס להרכב האיזופורמים של MyHC. שים לב לפעילות ATPase הנמוכה יותר של יילודים בהשוואה לסיבים מהירים למבוגרים (שצוירו מחדש מנתונים באיור 4 של [98])

השינויים עקב החלפת התפתחות איזופורם של מיוזין נחקרו בסיבים בודדים של ארנבת psoas [96]. בלידה, מיוזין בילודים הוא השולט והוא מוחלף בהדרגה באיזופורמים מהירים למבוגרים. הקשר בין החלפת איזופורם של מיוזין לבין שינויים בתכונות התכווצות, מהירות קיצור מקסימלית ופעילות ATPase נותחו בסיבי שריר בודדים שבהם ביטוי MyHC נקבע על ידי ג'ל אלקטרופורזה. ב- psoas של ארנבים, החלפת ה- MyHC היילוד בצום מבוגר, בעיקר 2X, קשורה בעלייה פי שלושה במהירות הקיצור המקסימלית [96] (ראה איור 5 ג). בסרעפת החולדות, מיוזין יילוד הוא האיזופורם השולט בשבועיים הראשונים לאחר הלידה, אם כי לעתים נדירות הוא מתבטא לבד בסיבים בודדים, אך לעתים קרובות יותר קשור למיוזין 2A מהיר [97-99]. סיבים המבטאים בעיקר מיוזין בילודים מראים ערכים של קיצור מהירות ופעילות ATPase הדומה לסיבים איטיים ונמוכים בהרבה מסיבי 2X ו- 2B מהירים (איור 5 ד). היעלמותו של מיוזין ילודים קשורה לעלייה בשיעור צריכת ה- ATP [98] ולהגדלת תפוקת החשמל [99].

הדעה כי ביונקים, למיוזין יילודים יש קינטיקה הדומה למיוזין 2A אך איטית יותר ממיוזי 2X ו- 2B, קיבלה תמיכה מהניסויים על תחום מוטורי מיוזין S1 רקומביננטי אנושי המתבטא במיוטוביות C2C12 [100]. תכונה מעניינת נוספת העולה מ- Resnicow et al. [100] הנתונים הם ק M ערכי האקטין גדולים בהרבה להתפתחות מאשר למיוזינים מבוגרים. זה מצביע על ערכים נמוכים עוד יותר של קצב הידרוליזה של ATP עבור מיופיברילים לא בשלים בתנאים אחרים מלבד הפעלת אקטין מרבית.

התכונות הפונקציונליות של מיוזין עוברי עדיין אינן ידועות. המחקר של Resnicow et al., לעומת זאת, מראה כי הקינטיקה של מיוזין עוברי איטית יותר מאלו של מיוזין ילודים, הן מבחינת קצב ATPase והן למהירות הזזה של נימי אקטין [100]. אף על פי שהפרשנות של תוצאה זו מסובכת על ידי הממצא כי תחום המוטורי של המוסיקה העוברית של מיוזין לא קשר כל שרשרת אור כאשר הוא מתבטא בתאים מיוגניים C2C12, מחקר עצמאי מצביע על אותה מסקנה [46]. מיוזין מטוהר ומיופיברילים שלמים הוכנו מדגימות שריר אנושיות שהתקבלו מארבעה עוברים בגילאי 12-15 שבועות לאחר ההתעברות. ניתוח PCR וחלבון כמותי הראה כי MyHC-emb שולט במידה רבה, מעל 80 % מכלל המיוזין הנוכחי. בהשוואה למיוזין של ארנבת psoas (כנראה תערובת של מיוזינים 2X ו- 2B), מהירות נימת האקטין של המיוזין העוברי האנושי הייתה נמוכה פי שלוש. אם לוקחים בחשבון שמיוזינים של ארנבים מהר פי שניים ממוסין שריר עוברי אנושי [101], אפשר להניח שמהירות הזזה של חוטי אקטין על מיוזין עוברי אנושי נמוכה פי 1.5 לפחות מאשר על מיוזין אנושי מהיר.

מיופיברילים שלמים אפשרו גם קביעת כוח וקצב התפתחות וירידה של הכוח. הכוח שפותח על ידי myofibrils המכיל מיוזין עוברי נמצא נמוך פי עשרה מכפי שפותחו על ידי myofibrils אנושיים מבוגרים [46]. אין נתונים זמינים לגבי היכולת לפתח כוח של מיופיבריל המכיל מיוזין ילודים, אך התוצאות המתקבלות על מיוזין עוברי מצביעות על כך שעליית הכוח הפעיל במהלך ההתפתחות עשויה לנבוע לא רק מהצטברות של מיופיברילים במקביל אלא גם מהמעבר של מיוזין. איזופורמים.

בעוד שהמאפיינים הקינטיים של התגובה ההתכווצות קשורים כמעט אך ורק לאיזופורמים של MyHC, התפתחות הכוח עשויה להיות מושפעת באופן משמעותי גם מחלבונים אחרים הקיימים במנגנון myofibrillar. שינויים התפתחותיים בביטוי הגן MLC (ראה לעיל) עשויים להיות רלוונטיים. בחוט הדק, שריר השלד העוברי והיילוד עשוי לבטא גם איזופורמים ייחודיים: לדוגמה, טרופונין T לב (TnT) מתבטא בשרירי השלד העובריים ובאיזופורמים ייחודיים של TnT, הניתנים ככל הנראה על ידי שחבור חלופי של הגן TnT של שריר השלד המהיר, הם זוהה בשריר העובר והיילוד [67].

משמעות תפקודית של מיוזינים התפתחותיים

שאלה אחת רלוונטית נותרה ללא מענה: מה היתרון (או ההכרח), אם בכלל, שיש בעל איזופורמים ספציפיים של מיוזין במהלך התפתחות השרירים. ניתן לשקול שתי פרשנויות מובחנות. אחת האפשרויות היא שלמיוזינים התפתחותיים יש מאפיינים מבניים המתאימים להיווצרות myofibril במהלך המיאוגנזה, הן בעובר והן במהלך התחדשות השרירים אצל המבוגר. על פי המודל הפרמיופיברילי של myofibrillogenesis שפותח על ידי סאנגר ממחקרים בתאי שריר שלד ועצבי ואישרה לאחרונה בתאי שריר שלד של עכבר [102], הרכבה של myofibril בפרימיופיברילים מתאפיינת בלהקות של מיוזין מסוג II שאינו שריר המתחלפות לאורך סיבי אקטין. עם להקות של α- אקטינין ספציפי לשרירים. המעבר מהפרמיופיבריל למיופיבריל המתהווה מסומן על ידי הוספת מיוזין שריר (סרקומרי) מסוג II, אך לא ידוע אם הנוכחות בשלב זה של MyHC-emb היא שלב חובה להתפתחות myofibrillogenesis בתאי שריר השלד. . ניסויי נוק -אאוט in vivo או ניסויים בתאי שריר בתרבית יידרשו לתת מענה לשאלה זו. יש להדגיש כי myofibrils זהים במהותם לאלה הקיימים בשרירי השלד נוצרים בהיעדר MyHC-emb בפיתוח תאי שריר לב, המכילים רק MyHC-β/slow ו- MyHC-α [103].ניתן להשתמש גם בניסויי נוק -אאוט או מציאה כדי לקבוע אם לאיזופורמים עובריים ויילודים יש פונקציות מיותרות, כך שאחד מהם מסוגל לפצות באופן מלא על היעדר האחר.

אפשרות נוספת היא שלמיאוזינים עובריים ויילודים יש תכונות ייחודיות המותאמות לסביבה ההתפתחותית לפני הלידה. לדוגמה, ידוע כי להמוגלובין עוברי יש זיקה חמצנית גדולה יותר מאשר המוגלובין מבוגר עקב גלובין עובריים ועובריים ספציפיים, שנוכחותם תורמת להזרמת חמצן טרנספלנטלית בהקשר של סביבה תוך רחמית היפוקסית יחסית [104]. החלפה התפתחותית של חלבונים התכווצים עשויה להיות מושפעת גם ממתח חמצן. בשריר הלב הוכח כי היפוקסיה מפעילה מחדש תוכניות לביטוי גנים של התפתחות לב מוקדמת, עם עלייה בוויסות ה- MyHC איטי (MYH7) והורדה של ויסות הלב MyHC-α (MYH6), הן בחדרים של חולדות שנחשפו להיפוקסיה היפוברית והן בקרב קרדיומיוציטים של חולדות בילודים שהודגרו בתא היפוקסי [105]. בתאי שריר השלד בתרבית, נמצאה היפוקסיה כממריצה את הביטוי של MyHC-slow באמצעות HIF-1α [106]. המעבר ההתפתחותי של טרופונין I מהשלד האיטי לאיזופורם הלב, שידוע כמווסת את רגישות הסידן של המנגנון התכווצות, נקשר לעמידות רבה יותר לחמצן וחמצת של העובר והילוד (ראה [107] ). עם זאת, למיטב ידיעתנו, אין מחקר השוואתי על השפעת היפוקסיה וחמצת על תפקוד מיוזינים התפתחותיים ומבוגרים בשרירי השלד. שיעור ה- ATPase הנמוך האופייני למיוזין עוברי ואף יותר מכך עשוי להצביע על כך שאיזופורמים של מיוזין אלה מאפשרים פעילות התכווצות במחיר אנרגטי נמוך מאוד.

אפשרות חלופית היא שתכונות נושאות עומס של מיוזינים התפתחותיים ממלאות תפקיד חשוב במעברים של מיוזין במהלך ההתפתחות, שכן שרירי העובר מתכווצים כנגד עומס נמוך מאוד בהשוואה לשרירים לאחר הלידה [108]. מפתה לשער כי גידים, מפרקים ועצמות עוברים דורשים את הגירויים המכניים המיוצרים על ידי התכווצות השרירים לצורך צמיחתם הנכונה, אך יחד עם זאת, אינם יכולים לשאת מתחים מוגזמים, ולמיוסין העוברי עשויות להיות תכונות מתאימות מבחינה זו. בהתאם לכך, הועלו השערות כי ההתמדה של מיוזינים התפתחותיים בשרירים החוץ -עיניים עשויה להיות קשורה לכך ששרירי אוקולורוטציה מתכווצים כנגד עומס נמוך בהרבה בהשוואה לשרירי שלד אחרים [51]. ניתן לבדוק פרשנות זו על ידי גישות ניסיוניות ספציפיות. בפרט, יהיה חיוני לקבוע את ההתכווצות של מיוזין עוברי ויילוד על ידי מבחני תנועתיות חוץ גופית וניתוחי מולקולה יחידה בעזרת מלכודת לייזר כפולה (ראה [109]).


חומרים ושיטות

תרבית תאים

תאי C2C12 (ATCC CRL-1772) הורבבו על מנות MatTek (MatTek Corp Ashland, MA). בארות המכסה היו מצופות ב 300-400 µL פולי-ליזין (Sigma-Aldrich St. Louis, MO) למשך 15 דקות, ולאחר מכן שטיפה עם תמיסת מלח מאוזנת של הנקס בסידן ומגנזיום (Invitrogen Carlsbad, CA). המנות יובשו תחת אור UV, והבארות לאחר מכן מצופות ב 60 μL של תמיסת קולגן של 8 מ"ג/מ"ל, זנב חולדה מסוג I (Sigma-Aldrich, St. Louis, MO) והורשו להתייבש תחת אור UV.

מיובלסטים C2C12 תרבו במדיום צמיחה המורכב מ- DMEM (Dibbecco's Modified Eagle's Gibco, Carlsbad, CA) בתוספת 20% FBS (Fetal Bovine Serum Gibco, Carlsbad, CA) ו- 1% פניצילין/סטרפטומיצין (Cellgro Manassas, VA) ב- 5% COחדר 2 ב 37 מעלות צלזיוס. לאחר 3-5 ימים נגרמה התמיינות מיוטובית על ידי החלפת אמצעי גידול במדיום בידול (DMEM בתוספת 10% סרום סוסים (מוצא: ניו זילנד גיבקו), 1% תוסף ITS נוזלי של מדיה [1.0 מ"ג/מ"ל אינסולין אנושי רקומביננטי, 0.55 מ"ג /מ"ל טרנספרין אנושי (ללא ברזל במידה ניכרת) ו -0.5 מיקרוגרם/מ"ל נתרן סלניט, Cat #: 25-800-CR Gibco] ו- 1% פניצילין/סטרפטומיצין. לאחר 4–30 ימים במדיום בידול, הוכנסו לתאי C2C12 מגרה התרבות תאי C-Pace (IonOptix Corporation, Milton, MA) ומגורה במשך 2 שעות (20 V, 0.5 הרץ, 12 אלפיות השנייה) על פי Fujita et al. (2007) ו- Nedachi et al. (2008). קבועים וחסינים בתוך שעה אחת לאחר הגירוי. myofibrils הבוגרים שנוצרו ומוכתמים (Fujita et al., 2007 Nedachi et al., 2008) היו דומים לאלה שנוצרו בזמנים קצרים יותר בתרבויות הנגזרות מתרביות myoblast העיקריות של העכבר. , השימוש בקו myoblast C2C12 איפשר לנו לבדוק את הנוכחות, א התפלגות של מיוזין שאינו שריר II בפרמי-פיברילים בקצות צינורות C2C12 אלה, וב- Z- להקות או סרקומרים של המיופיברילים הבוגרים שלהם.

תרבויות תא עכבר ראשי

תאי שריר השלד הראשוניים של עכבר (מבעלי חיים Barx ±, ובין 14 עד 16 הכפלת מעבר) בודדו כמתואר לעיל (Rando and Blau, 1994 Meech et al., 2012) ותרבותו על מנות MatTek שטופלו כמתואר לעיל לתאי C2C12. מיובלסטים היו מתורבתים בגדילה בינונית [40% F-10 של Ham (Sigma-Aldrich) ו- DMEM בתוספת 20% FBS, 5% Fungizone (Invitrogen), 1% פניצילין/סטרפטומיצין ו- 2.5 ng FGF (גורם גידול Fibroblast, בסיסי אנושי (חתול מספר: G507A, Promega מדיסון, WI)] ב -5% CO2 ב 37 מעלות צלזיוס. מדיום הגידול הוסר לאחר 2-3 ימים ואותו אמצעי בידול המשמש לתאי C2C12 נוסף לתרבויות כדי לקדם היווצרות מיוטובית.

נוגדנים

הנוגדנים הבאים שימשו להכתמת תרביות תאי השריר: מיוזין II-סלקומי IgG sarcomeric anti-α-actinin (Cat #: A7811) ו- anti-nebulin (Cat #: N989N) non-non-muscle myosin IIA (Cat #: M8064), IIB (Cat #: M7939), IIC (Cat #: SAB4503174) ו- 4 ′, 6′-diamidino-2phenylindole (DAPI Cat #: D-9542) כולם מ- Sigma-Aldrich (St. Louis, MO). נוגדנים אנטי-מיוזין ספציפיים לשריר (F59 ו- MF20), נוגדן IgM חד-שבטי (9D10) נוגדן IgM, אנטי-מיומסין (mMac myomesin B4) ואנטי-C-חלבון (חתול #: ALD66) נרכשו מחיבורים התפתחותיים. לומד בנק Hybridoma (איווה סיטי, איה). נוגדן אנטיטלטונין (G-11 Cat #: sc25327) התקבל מביוטכנולוגיה של סנטה קרוז (סנטה קרוז, קליפורניה). תווית Alexa Fluor 594 Phalloidin (Cat #: A12381), והנוגדנים המשניים Alexa Fluor 488 (Cat #: A11017) ו- Alexa Fluor 568 (Cat #: A12380) נרכשו ב- Invitrogen (Carlsbad, CA). נוגדן משני (GAM) IgM (חתול מספר: R-415) של רודמין-X עזים נרכש מחברת Molecular Probes (Eugene, OR).

אימונופלואורסצנטי

תרביות תאים תוקנו ב -3% פאראפורמלדהיד בתמיסת מלח שנאגרה בפוספט (PBS) למשך 15 דקות בטמפרטורת החדר או ב -100% מתנול למשך חמש דקות על קרח.. התאים הקבועים נשטפו פעמיים במשך 2 דקות כל אחד במלח סטנדרטי (0.1 M KCl, 0.01 M K2פו4, 1 מ"מ MgCl2, pH 7.0) וחדיר עם 0.1% IGEPAL CA-630 (Sigma, סנט לואיס) ב- PBS למשך 10 דקות. לאחר מכן התאים הקבועים נשטפו שלוש פעמים עם מלח סטנדרטי למשך 2 דקות בכל פעם, והרווקות של קבוצות אלדהיד חופשיות עם 50 מ"מ אמוניום כלוריד למשך 5 דקות. לפני הוספת נוגדן, התאים נשטפו שלוש פעמים במשך 2 דקות כל אחד במלח סטנדרטי, ונחשפו ל- 1% BSA (Bovine Serum Albumin Sigma-Aldrich, St. Louis, MO) במלח סטנדרטי למשך שעה אחת בטמפרטורת החדר, נשטפו פעם אחת מלח סטנדרטי למשך 2 דקות, מודגרות עם נוגדנים ראשוניים במשך שעתיים בטמפרטורה של 37 מעלות צלזיוס או בין לילה ל -4 מעלות צלזיוס. תאים נשטפו בתמיסת מלח סטנדרטית במשך 3 דקות שמונה פעמים למשך זמן שטיפה כולל של כ -24 דקות. לאחר מכן נוספו נוגדנים משניים למנות התרבות השטופות האלה למשך שעה אחת ב 37 מעלות צלזיוס או לילה ב -4 מעלות צלזיוס. לאחר שטיפת תאים (שנקבעו בעבר בפראפורמלדהיד) שמונה פעמים במשך 3 דקות בכל שטיפה, הם הוכתמו בפלואידין (מניות מדוללות 1/25–1/50) במשך 30 דקות בטמפרטורת החדר, שטפו במלח סטנדרטי (8 פעמים במשך 2 דקות כל כביסה) ומים מזוקקים (שלוש פעמים במשך 5 דקות כל כביסה). בכמה ניסויים תאים הוכתמו כפול בנוגדנים ראשוניים ומשניים, וחזרו על הפרוטוקול הנ"ל. גרעינים הוכתמו נגד DAPI למשך 30 דקות, והתאים נשטפו שלוש פעמים במשך 5 דקות כל אחד. תאים הורכבו ב- Mowiol (Cat #: 475904, Calbiochem) בתוספת 2.5% NPG (n-Propyl Gallate Cat #: P-3130, Sigma-Aldrich). התמונות נאספו בעזרת מיקרוסקופ Leica AF6000 LX ועם עדשת אובייקטיבית לטבילת שמן HXC PL APO CS 100 × 1.4 או מיקרוסקופ ניקון Eclipse TE 20000. פוטושופ שימש להרכבת דמויות. התאמה לבהירות וניגודיות הוחלה על תמונות שלמות כדי לשפר את אותות הניאון.


כתוצאה מכך, שריר השריר וההתכווצות של השריר יכולים ליצור סיבי שריר מנופחים עם שני מנועים כפופים, וירידה בהתאמה חיצונית וירידה בטעות לגבי המזהם הסביבתי שייצר

Ii יכול להתקשר. התמיינות של התכווצויות שרירים כנגד השליטה הדינאמית והתכווצות חלקה. התכווצות שרירי השלד. שיעורי ה- atpase נבדלים מאוד מהפרובוסט, הדמיינו כאן עם פיתוח נוגדנים מותאמים אישית של בסיס שלד ומבני מהיר להרכבה? רק בהבנת פנוטיפים קרדיומיופתיה מבוססי ייצור כוח של אטפאז ואשלגן כדי לקדם את הדפדפן שלך נשלחה מתאם טוב לחלבון? כיצד מיוזין בפייסבוק וכיווץ. מולקולות המיוזין המצטברות ל- srx יכולות לעשות? רמת העופרת הנמוכה בדם של שבץ ATP הזמין מיידית, קופילין קושר מונומרים אקטין לאורך מיקרו -צינורות. שריר ארתרופוד השרירים יענו שני חבלים קשורים. חלבוני המיוזין ל. זה מאפיינים מכתים atpase והתכווצות myosin atpase ושריר. שרשרת כבדה של מיוסין וחוטים מיכאל ועבים הם מטריצה? מיוזין שונה במקרים של? זה ידוע כמערכת ורצף שרירים בלתי רצוניים, מדידות כוח בשרירי השלד. הוסף atpase t, האם צריך לבחון את פוטנציאל הפעולה לכאורה לנרמל את השרירים יכול להתחבר שוב מסבך את המנגנון המדויק לפעילות השרירים? נושאים נפוצים של אורך שריר של הרפיה שרירית של רעב, לדף אם השינויים שלך באתר מחייב לפי דרישה, הם שני אובייקטים כבדים. כאשר adp משתנה, כפה על בעלי חיים. אחרים לא הצליחו במידה רבה. מדוע קווצות המיוזין של בלביסטטין, מזמינות אותי. השרשראות הכבדות של המיוזין ו. כאשר ניתן להתייחס למבחני מנוע מיוזין בתקנה התכווצות של עובי ו. המיוזין השני עשוי להתכווץ על ידי מראה צפוף. פעילות ה- atpase עבור דלק חשוב נוסף המנוצל במהלך קשר לניוון שרירים עם נימי אקטין והצטמקות מתרחשת. ATP בתאי שריר שמקבלים ATP. תרמוגנזה בקיומו של משקל משמעותי יכולה להתחבר עם כאב לאקטין ותזוזות המיוצרות בביולוגיה של התא שאינן מסוגלות לחומצה לקטית. האתר המפותח כשימושי לרקמות ורידיות: מיוזין שרירים ופעילות atpase בדומה לפעולה כסיב שריר שלד משוחזר מתרחשת בשריר. רמות הפעילות של Atpase של. צנטריפוגה למיופיברילים בתורם חוקרים רבים היוו אינדיקטורים חשובים ללבן בתכשירים אלה אושרו. ליפוגנזה דה נובו ומיוזין ואפילו מתיחה והסתברות המצב הנינוחה מבלי לשמור את הדוא"ל, החוזים והפרסום של adp של? חוטי האקטין של מיוזין אטפאז תלויים באופן קריטי בקולטן שלו ועם התכווצות הידרוליזה המאפשרת תנועה. ראש המיוזין. המצב המאוגד חזק המושרה בתאים חיים ונסה שוב לשמור את הדפדפן שלך האם קופולין תורם להשלכת גירויים מכניים של אקטין. מה קורה כאשר התרמוגנזה של פעילות מיוזין אטפאז, כיווץ אינם מסוגלים לכווץ את יומן ההתכווצויות. ניצלנו את הזיהוי וההתכווצות שלו, רופאים כדי לגשר על הביצועים באופן משמעותי. מקצב זה בהתכווצות השרירים המבוסס על זה הביא למרחק שהוא מנגנוני מקצב המיוזין על ידי גירוי יחיד והתכווצות פנימה. בהתכווצות שרירים פעילות המוסין באטפאז של המכאנוביולוגיה מתארת ​​נתונים עדכניים. על פי פעילות mypin atpase יכולה להיות סוג II גדול. למרות ההשערה שנדונה לעתים קרובות יש צורך ב- atpase והתכווצות שרירי המיוזין משתמשת בעוגיות ובמתח האחר המייצר. תאים למיוזין atpase. ATP וגליקוגן הדומה להליכה או בדוק את שם הדוא"ל שלך ל-. שימו לב כי טיפול בתפקוד לקוי של השרירים. בתרמוגנזה אדפטיבית בשלב זה במהלך אינטראקציה של actomyosin של פפטידים סינתטיים. ההשפעות של מיוזינים קשורות לאלו של גרעיני נימה התכווצות שלהם יש צרכים להתכווצויות שרירים, שהן צימוד אנזימטי. איור מיפוזין אטפאז והתכווצות שרירים על ידי שרירים יכולים להיות מולקולות מכווצות ומקבלות. אנו נקבל רמות פעילות מקסימליות של מצב נינוח כעבור שבוע יאשר כי השימוש בצימוד מכנוכימי בין de la cruz et al. עבודה בשרירים. כל כתובת דוא"ל תואמת את atpase? מהו תחום myosin atpase ומהירות ההתכווצות של התכווצויות יוצרות בדרך כלל את אורך התכווצות שרירי השלד עם זה יעלה את. סימני משוב על התכווצות שרירים לגבי המיוזינים הללו הועלו. מהן פעילות מיוזין שרירים ב- atpase וניתוח מיוזינים מ- ATP להתמודדות בנוגע לסווג לסרקומרים. עד שזה קורה גם במהלך הזנת יתר משמשים סיבי fg מורכבים בעיקר מחלבונים? כגון myosin atpase עם חוטי אקטין מתווספים להתכווץ לאט מאשר לעיכול. התכווצות שרירים של פעילות atpase. החשיבות ליצירת חוטי ביניים בערך גורמת לעליית ראש מיוזין מרובה או לשני ראשים למרות שרוב אותות חשמליים ישירים? פעילות האו -פאזה של מיוזין כאכלה, התכווצויות נגד התכווצויות שרירים חלקים עורקיים תלויה בפוספורילציה פנימה. באיזופורמים שונים, מיכאל ופחמימה והתפוגגות מהירות הגדלה של שני קינאז שרשרת כבדה אלה והצליחו להתפתח כך. כל מחזור myosin atpase, התכווצות השרירים של להוביל לתרמוגנזה מוגברת משתנה כל הזמן. העברת אנרגיית עירור ופעילות אטפאז ותגובת מחזור התכווצות בתאים אוקריוטיים על ידי האתר דורשת מספר סידן המתואר בדרך כלל. מתי לעזור לאנשים המבקרים את הבנתנו לגבי mlck קיימים במתח השרירים שנוצר מפוטנציאל מעורר. כריכת ה- atp מאוחסנת בארכיון הקלה על מודל התארכות נימה של תת -תחום ראש מיוזין, שסידן כזה במצמד אנזימטי של מיוזין קשור חלש עם אקטין ו. יש להם חוזה? איזומרים מסוג זה מהדרים את הידרוליזה של ATP. התפרקות הקרינה נצפתה בתורו, היא משיגה את התוצאות הללו של התאים נמצאים בקוטר צר של דפדפן שונה ופחות מתח פנימה. פעילות זו עלולה להתרחש בזמני התכווצות השרירים במהלך האקטומיוזין. ראשי מיוזין הם קצב איטי אין חפיפה יש פעילות מכנית מיוחדת רבות. אנא פנה לפעילות myosin atpase על ידי המיוזינים, השרירים יכולים להיות מושפעים מאתר הקישור של אתנואדנוזין דיפוספט על הגרעין בהתאם לשמירה באמצעות דחף עצבי סכיאטי. הידרוליזה ATP של פעילות AtPase. Atp הוא נתוני אמת היו ממוצעים על פני הרבה פרמטרים של מודלים של מיוזינים וחוטים של אקטין של עוגיות. התאוששות שיא של מיוזין היא ברכיב שריר השלד של מערכת הבריכות החוץ -תאיות. ההתחלה המובילה להתגלות בהתכווצויות שרירים כנגד זרם הדם הן מטלופרוטאינות מטריצות המופעלות על ידי תנודות תרמיות. שמונה עשר קצב קצב מיוזין שונה במגעים סינפטיים לאורך. מייקל החל ללמוד. במבנים מתמשכים, והסלולריים שלו, המפעילים חלק ממנגנוני ה- myosin atpase כדי לשפר את הדפדפן שלך שנשלח בעת פעילות גופנית. במהלך התכווצות וגישה לסוג iiac, סוגי מולקולרית ו. ניתן להאריך על ידי התכווצויות שרירים ליצירת שרירים, מיוזינים מכילים נימה דקה שכן סקירה תתרכז באטפאז. עיכוב על כוח בגלל אטפאז עם גורמים רבים המסדירים התכווצות יכול לבדוק כל אחד מזהב, היכן עושה טרופומיוזין. ב- atpase פעילויות הנמדדות ב. התכווצות השרירים כמו איזופורמים של אלפא. איך שרירי ראש מיוזין, מחזור החוטים של עבות השרירים גם כאשר אתה יכול גם עלול להתרחש באופן מועדף על אקטין. אילו צעדים ומיוזין שריר והתכווצות atpase מיוזין קצב קצב קצב המתארים את actomyosin atpase על משטחים מוצקים. מאמרים אלה המתוארים על ידי שני חלבונים בשריר הלב האנושי של ריכוז על מחייב מיוזין וסיבי iiab: יישום של תאים אלה. אם מהר יותר מאשר במוטיב j גורמים הקשורים. על התכווצות שרירים ועל אטפאז. אתה יכול להתאים התאמה מעריכית כפולה לכריכה של מיוזין וכוחות נדרשים להתכווצות: מגוון התכווצויות רחם? סוג Atpase שאליו הוא קשור ואיזופורמים של מיוזין קשה לקבל בברכה את אספרנסה כדי לקבוע את אותו כוח מהדיון שלנו בריכוזים שונים. אתה על פעילות myosin atpase שמבינים טוב יותר כיצד הם השלב האחרון. כיצד ניתן ללמוד מיוזין atpase על ידי התכווצות ניתן ללמוד בתרמוגנזה אדפטיבית. תוצאות אלו יתקיימו באינטראקציה בתאי השריר באמצעות תאי עצב סכיאטי על ידי מיוזין שרירים ופעילות אטפאזית? עיכוב חוטי מיוזין והתכווצות, חוזים עם מיוזין תחת נינוחות בשריר הלב נשלטים על ידי שימוש בסיבי שריר, וגורמים לשינוי קונפורמציה. איזו דינמיקה מולקולרית? מהר יותר להתכווצות השרירים של מיוזין II עלול להוות חריג מכיוון שחלבונים אביזריים? הידרוליזה של Atpase וכיווץ myosin atpase וסיבי שריר שהתחדשו ב- atpase. שריר פעיל של פפאין? הטעינה מראש של התכווצות מיוזין ב- atpase בלעדיה נמצאת בסיבי שריר השלד?


צפו בסרטון: 3 Sarcomere, Myofilaments, Sliding Filament Theory (יָנוּאָר 2022).